Cloning and application of a key gene peirx10 for xylan synthesis of moso bamboo

A key gene, xylan technology, applied in the field of cloning and function preliminary exploration of the key gene PeIRX10 of Phyllostachys pubescens glycosyltransferase

Active Publication Date: 2019-12-24
ZHEJIANG FORESTRY UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the research on the function of IRX10 gene in existing plants mainly focuses on model plants such as Arabidopsis thaliana and rice, but the key gene PeIRX10 involved in xylan synthesis in moso bamboo has not been reported so far.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cloning and application of a key gene peirx10 for xylan synthesis of moso bamboo
  • Cloning and application of a key gene peirx10 for xylan synthesis of moso bamboo
  • Cloning and application of a key gene peirx10 for xylan synthesis of moso bamboo

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Phyllostachys pubescens PeIRX10 gene expression

[0024] (1) Experimental method

[0025] 1. Moso bamboo material

[0026] Moso bamboo materials of different tissues were obtained from the roots, stems, leaves, inflorescences and young shoots of 1-year-old seedlings, which were quick-frozen in liquid nitrogen and stored at -80°C for the extraction of total RNA.

[0027] (1) RNA extraction and cDNA synthesis

[0028] Perform BLAST retrieval and comparison analysis on the sequenced gene sequence database and its corresponding protein sequence database in Phyllostachys pubescens, obtain the nucleotide sequence of PeIRX10 gene (PH01004923G0080; SEQ ID No: 1), and design primers as follows:

[0029] PeIRX10-F1:5'-CCTGAACCACATGTTTGCCG-3' (SEQ ID No: 2)

[0030] PeIRX10-R1:5'-AATCGCACTGCGCATCATTC-3' (SEQ ID No: 3)

[0031] The total RNA of each sample of Phyllostachys pubescens was extracted with RNA extraction kit (OMEGA). Reverse transcription was performed us...

Embodiment 2

[0039] Example 2 Overexpression of Phyllostachys pubescens PeIRX10 gene in Arabidopsis thaliana

[0040] (1) Experimental method

[0041] 1. Construction of expression vector

[0042] Based on the Gateway system for PCR amplification of the full-length cDNA sequence of Phyllostachys pubescens PeIRX10, the amplification primers are:

[0043] PeIRX10-F:

[0044] 5′-

[0045] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAGGAGGTGGGTCTTGGCC-3' (SEQ ID No: 6);

[0046] PeIRX10-R:

[0047] 5′-

[0048] GGGGACCACTTTGTACAAGAAAGCTGGGTCCCAAGGCTTCAGGTCGCCCACCG-3' (SEQ ID No: 7).

[0049] The PCR reaction system is 20 μL: 10 μL of 2×PrimeSTAR Max Premix, upstream and downstream primers (10 μmol L -1 ) each 0.5 μL, template 2 μL, dd H 2 O 7 μL. Reaction program: pre-denaturation at 94°C for 5 minutes; 35 cycles at 94°C for 30s, 1min at 55°C for 30s, and 30s at 72°C; extension at 72°C for 10min. The amplified product was ligated with pDONR207, transformed into DH5α, and positive clones were obt...

Embodiment 3

[0061] Example 3 Cell wall xylan immunolocalization

[0062] (1) Experimental method

[0063] Take the stems at the base of wild-type, double-horn plants and complementary Arabidopsis plants that have grown for eight weeks, cut them into 1mm-thick slices, wash the slices with 0.1M phosphate buffer (pH 7.2) for 5-10min; use fresh Soak the slices in 3% skimmed milk for 1 h and blow the skim milk continuously; remove the skim milk and wash the slices with PBS buffer for 5 min; incubate the slices with rat anti-xylan antibody LM10 (Plantprobes) for 2 h, then wash the slices with PBS buffer to Wash unbound primary antibody; incubate with 50-fold diluted FITC-goat anti-rat antibody (Zomanbio, Cat.Z1319) for 2 h, then wash the section with PBS buffer 10 times to wash unbound secondary antibody; finally The slices were fixed on glass slides, observed and photographed under a laser confocal electron microscope (ZeissLSM710, 495nm), and the results are shown in the attached Figure 4 ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the fields of molecular biology and genetic engineering, and particularly relates to a Gts (glycosyltransferases) key gene PeIRX10 taking part in xylan synthesis. The gene has the nucleotide sequence shown as SEQ ID No:1. The invention provides a powerful tool for knowing the formation of the secondary cell wall and illuminating the molecular basis of the fast growth of phyllostachys edulis tissues. The effects that the xylan synthesis defects in arabidopsis mutants can be overcome by using the PeIRX10, and the defects of the secondary cell wall in the arabidopsis mutants can be overcome in a complementary way are achieved.

Description

technical field [0001] The invention belongs to the fields of molecular biology and genetic engineering, and specifically relates to the cloning and functional exploration of a key gene PeIRX10 of moso bamboo glycosyltransferases (glycosyltransferases, GTs) involved in xylan synthesis. Background technique [0002] Hemicellulose xylan (Xylan) is a polysaccharide component second only to cellulose in plants. It plays an important role in maintaining the stability and integrity of cell walls and is an important renewable biomass resource. Xylan is synthesized by GTs located in the Golgi. GTs are a series of enzymes involved in catalyzing the synthesis of sugar chains in disaccharides, polysaccharides, and sugar complexes. They exist in all organisms and not only participate in the synthesis of the main components of the cell wall, but also catalyze the sugar groups of various molecules and participate in development. , signal transduction, defense and other biological process...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/54C12N15/82A01H5/00A01H6/46
CPCC12N9/1048C12N15/8205C12N15/8246C12N15/8259
Inventor宋丽丽王杰吴蔼民应叶青郭小勤
OwnerZHEJIANG FORESTRY UNIVERSITY