Cloning and application of a key gene peirx10 for xylan synthesis of moso bamboo
A key gene, xylan technology, applied in the field of cloning and function preliminary exploration of the key gene PeIRX10 of Phyllostachys pubescens glycosyltransferase
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Example 1 Phyllostachys pubescens PeIRX10 gene expression
[0024] (1) Experimental method
[0025] 1. Moso bamboo material
[0026] Moso bamboo materials of different tissues were obtained from the roots, stems, leaves, inflorescences and young shoots of 1-year-old seedlings, which were quick-frozen in liquid nitrogen and stored at -80°C for the extraction of total RNA.
[0027] (1) RNA extraction and cDNA synthesis
[0028] Perform BLAST retrieval and comparison analysis on the sequenced gene sequence database and its corresponding protein sequence database in Phyllostachys pubescens, obtain the nucleotide sequence of PeIRX10 gene (PH01004923G0080; SEQ ID No: 1), and design primers as follows:
[0029] PeIRX10-F1:5'-CCTGAACCACATGTTTGCCG-3' (SEQ ID No: 2)
[0030] PeIRX10-R1:5'-AATCGCACTGCGCATCATTC-3' (SEQ ID No: 3)
[0031] The total RNA of each sample of Phyllostachys pubescens was extracted with RNA extraction kit (OMEGA). Reverse transcription was performed us...
Embodiment 2
[0039] Example 2 Overexpression of Phyllostachys pubescens PeIRX10 gene in Arabidopsis thaliana
[0040] (1) Experimental method
[0041] 1. Construction of expression vector
[0042] Based on the Gateway system for PCR amplification of the full-length cDNA sequence of Phyllostachys pubescens PeIRX10, the amplification primers are:
[0043] PeIRX10-F:
[0044] 5′-
[0045] GGGGACAAGTTTGTACAAAAAAGCAGGCTTCATGAGGAGGTGGGTCTTGGCC-3' (SEQ ID No: 6);
[0046] PeIRX10-R:
[0047] 5′-
[0048] GGGGACCACTTTGTACAAGAAAGCTGGGTCCCAAGGCTTCAGGTCGCCCACCG-3' (SEQ ID No: 7).
[0049] The PCR reaction system is 20 μL: 10 μL of 2×PrimeSTAR Max Premix, upstream and downstream primers (10 μmol L -1 ) each 0.5 μL, template 2 μL, dd H 2 O 7 μL. Reaction program: pre-denaturation at 94°C for 5 minutes; 35 cycles at 94°C for 30s, 1min at 55°C for 30s, and 30s at 72°C; extension at 72°C for 10min. The amplified product was ligated with pDONR207, transformed into DH5α, and positive clones were obt...
Embodiment 3
[0061] Example 3 Cell wall xylan immunolocalization
[0062] (1) Experimental method
[0063] Take the stems at the base of wild-type, double-horn plants and complementary Arabidopsis plants that have grown for eight weeks, cut them into 1mm-thick slices, wash the slices with 0.1M phosphate buffer (pH 7.2) for 5-10min; use fresh Soak the slices in 3% skimmed milk for 1 h and blow the skim milk continuously; remove the skim milk and wash the slices with PBS buffer for 5 min; incubate the slices with rat anti-xylan antibody LM10 (Plantprobes) for 2 h, then wash the slices with PBS buffer to Wash unbound primary antibody; incubate with 50-fold diluted FITC-goat anti-rat antibody (Zomanbio, Cat.Z1319) for 2 h, then wash the section with PBS buffer 10 times to wash unbound secondary antibody; finally The slices were fixed on glass slides, observed and photographed under a laser confocal electron microscope (ZeissLSM710, 495nm), and the results are shown in the attached Figure 4 ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


