Positive quality control product for detecting HBB/GJB2/ATP7B/PAH genetic disease genes and preparation method of positive quality control product

A positive quality control substance and positive plasmid technology, applied in the fields of molecular biology and medical testing, can solve the problems of inability to truly simulate human genomic DNA, inability to cover other regions of genomic DNA, inappropriate sequencing, etc. Specific quality control, easy-to-prepare results

Active Publication Date: 2016-09-07
GUANGZHOU DARUI BIOTECH +1
View PDF6 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] There are two methods for preparing positive quality control products in traditional genetic disease detection kits: 1. Directly dilute the recombinant plasmid with a single PCR product positive for mutations to 10 3 Copies / μL is used as a positive quality control product. The quality control product prepared by this method can only cover the insert fragment containing the specific mutation site, but other regions of genomic DNA cannot be covered; 2. Two or more mutation positive The recombinant plasmids of the PCR products were mixed in proportion and diluted to 10 3 Copies / μL is used as a positive quality control substance. Although this method can simulate the detection of two or more mutation sites, it cannot cover other regions of genomic DNA; neither of the above two quality control substances can truly simulate human genomic DNA.
For the modern high-throughput sequencing technology that can sequence hundreds of thousands to millions of DNA molecules at a time, the sequencing of quality control products prepared by mixing single or several PCR products is obviously not suitable.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Positive quality control product for detecting HBB/GJB2/ATP7B/PAH genetic disease genes and preparation method of positive quality control product
  • Positive quality control product for detecting HBB/GJB2/ATP7B/PAH genetic disease genes and preparation method of positive quality control product
  • Positive quality control product for detecting HBB/GJB2/ATP7B/PAH genetic disease genes and preparation method of positive quality control product

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Embodiment 1: the establishment of positive quality control product preparation method

[0057] (1) Two cases of wild type Human Genome DNA (WHGD) acquisition:

[0058] WHGD was extracted from wild-type human genome peripheral whole blood sample A and sample B according to the operating instructions of the QIAamp DNA Blood Mini Kit kit (QIAGEN, 69504).

[0059] (2) Acquisition of mutation-positive plasmids:

[0060] 1) Insert design and synthesis:

[0061] Using bioinformatics related technology to design the insert sequence as:

[0062] ATGGACGTGCTCATCGTCCTGGCCACAAGCATTGCTTATGTTTATTCTCTGGTCATCCTGGTGGTTGCTGTGGCTGAGAAGGCGGAGAGGAGCCCTGTGACATTCTTCGACACGCCCCCCATGCTCTTTGTGTTCATTGCCCTGGGCC GTGGCTGGAACACTTGGCAAAGGTAACAGCAGCTTCAGGTTCAGAAAAGAGCTGCTCCTTCAGTAAACAAAATCTCACTTCCTCTGAACACCATGTTTAGAATTACTAATTATAC ATCTGGCTCACCGTCCTTCTTCATTTTTCGCATTATGATCC TCGTTGTGGCTGCAAAGGAGGTGTGGGGAGATGAGCAGGCCGACTTTGTCTGCAACACCCTGCAGCCAGGCTGCAAG AACGTGTGCTACGATCACTACTTCCCCATCTCCCACATCCGGCTAT...

Embodiment 2

[0104] Embodiment 2: the verification of positive quality control product

[0105] (1) Library construction:

[0106] According to the genetic disease-related HBB / GJB2 / ATP7B / PAH gene mutation detection kit, library construction was performed on the 6 cases of positive quality control products prepared in Example 1, and the constructed library was quantitatively used for sequencing.

[0107] (2) On-machine sequencing:

[0108] Template preparation and template enrichment were performed according to the kit instructions of Ion PGM HiQ OT2 Reagents 200 (Life Technologies, A26428) and Ion PGMHiQ OT2 Solutions 200 (Life Technologies, A26429).

[0109] On-machine sequencing was performed according to the kit instructions of Ion PGM HiQ Sequencing 200 Reagents (Life Technologies, A26431), IonPGM HiQ Sequencing 200 Solutions (Life Technologies, A26430) and Ion PGMSequencing Nucleotides (Life Technologies, A26432).

[0110] (3) Results:

[0111] Using biological information technolo...

Embodiment 3

[0115] Embodiment 3: repeatability test verification

[0116] (1) Reproducibility verification of the preparation method of positive quality control products

[0117] 1. Experiment:

[0118] Select 5 cases of wild-type human peripheral whole blood samples to extract genomic DNA, and operate according to the steps of Example 1 and Example 2 with the mutation-positive sequences to obtain 5 cases of positive quality control products, respectively PC-1, PC-2, and PC-3 , PC-4, PC-5, according to the operation steps of Example 2, these 5 cases of positive quality control products were experimentally verified.

[0119] 2. Results:

[0120] Using biological information technology for data analysis, the sequencing results of PC-1 / 2 / 3 / 4 / 5 are shown in the table below:

[0121]

[0122] The sequencing depth values ​​corresponding to the 4 mutation sites of the 5 quality controls in the above table are all ≥ 20, and the mutation frequency is 40% to 65%. The coefficient of variation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to a positive quality control product for detecting HBB / GJB2 / ATP7B / PAH genetic disease genes and a preparation method of the positive quality control product. A DNA sequence, which includes four mutant gene segments, namely HBB_CD41-42, GJB2_235delC, ATP7B_2333G>T and PAH_728G>A, is synthesized, and the sequence is interpolated into a plasmid vector and is mixed with wild-type human genome DNA according to a copy number of 2 to 1, so that the positive quality control product is obtained. The positive quality control product prepared by the invention, as a positive internal standard quality control material of a kit for detecting HBB / GJB2 / ATP7B / PAH gene mutation related to genetic diseases, can be used for accurately monitoring an entire experimental process of detecting the related genetic diseases with the adoption of the detection kit; therefore, the positive quality control product can serve as a standard for judging whether an experiment is successful or not.

Description

[0001] Field [0002] The present invention relates to the field of molecular biology and medical detection, and relates to a common genetic disease based on a high-throughput sequencing platform—a positive quality control product for gene detection of thalassemia, deafness, phenylketonuria and hepatolenticular degeneration. its preparation method. Background technique [0003] Genetic diseases refer to the abnormal traits of the offspring caused by the abnormality of the genetic material (chromosome, DNA) in the fertilized egg or the abnormality of the genetic information carried by the germ cells. Genetic diseases are divided into single-gene genetic diseases and polygenic genetic diseases. There are many types of single-gene genetic diseases with high incidence, which not only cause serious harm to the health of patients, but also bring heavy mental and economic burdens to families and society. burden. Therefore, it is very necessary to pass the genetic testing of early n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6883C12Q2600/166
Inventor 李明杨学习吴英松高旭年李尔华杨旭王小丽
Owner GUANGZHOU DARUI BIOTECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products