Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes
A technology of RT-PCR and avian influenza virus, applied in the field of biological virus detection, can solve the problems of single pathogen and cumbersome operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0058] Example 1: sample preparation and extraction of viral RNA:
[0059] Aseptically collect chicken throat swabs and internal organs (such as: trachea, lungs, lymph nodes, kidneys, spleen, etc.) Viral RNA was extracted using a column nucleic acid extraction kit from Shanghai Huirui Biotechnology Co., Ltd., and extracted according to the kit instructions.
Embodiment 2
[0060] Example 2: Primers and Probes
[0061] The gene sequences of avian influenza virus, Newcastle disease virus and infectious bronchitis virus from all over the world were downloaded from the NCBI gene bank, and their homology comparisons were carried out. Based on highly specific avian influenza virus M gene sequence (gene sequence number: AY300973), Newcastle disease virus gene M gene (gene sequence number: KR338979), infectious bronchitis virus M gene (gene sequence number: KF188434), use Bioinformatics method According to the principle of primer design, and using the Primer Express design software, several sets of specific primers and fluorescent probes for amplifying the above gene fragments were designed. The designed primers and probes were verified by BLAST (http: / / blast.ncbi.nlm.nih.gov / ) to ensure the high specificity of the primers. Furthermore, DNAStar software was used to verify whether primer-dimers were generated between each primer probe. After the above-...
Embodiment 3
[0065] Embodiment 3: the preparation of plasmid
[0066] Sequence of avian influenza virus positive reference:
[0067] TGAGTCTTTCTAACCGAGGTCGAAACGTACGTTTCTCTCTATCGTCCCATCAGGCCCCCTCAAAGCCGAGATCGCGCAGAGACTTGAAGATGTATTTGCAGGGAAAAATGCAGATCTTGAGGCTCTCATGGAAT.
[0068] Sequence of Newcastle disease virus positive reference:
[0069] GTGATGTGCTCGGACCTTCCGTACTTGTGAAGGCGAGAGGTGCACGGACTAAACTGTTGGCACCTTTCTTCTCTAGCAGTGGGACAGCCTGCTACCCTATAGCAAATGCCTCTCCTCAGGTGGCTAA.
[0070] Sequence of Infectious Bronchitis Virus Positive Reference:
[0071] TGCTATAGAGAGTGTGCCGATGGTGCTTTCTCCTATTATAAAGAATGGTGTTCTTTATTGTGAGGGTCAGTGGCTTGCTAAATGTGAACCAGACCACTTGCCTAAAGACATATTTGTATGCACACCAG.
[0072] According to the above sequence, the positive plasmid of the corresponding virus was constructed artificially, and after construction, the accuracy of the sequence was verified by sequencing, so that three kinds of plasmids each containing one target fragment were obtained.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap