Check patentability & draft patents in minutes with Patsnap Eureka AI!

RNAi vector constructed based on isocaudarner and application of RNAi vector

A homologous enzyme and homologous enzyme technology, which is applied in the field of RNAi vectors, can solve the problems of vector construction complexity and achieve the effects of simplifying the construction process, improving construction efficiency, and improving flexibility

Active Publication Date: 2016-11-09
ZHEJIANG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The above vectors for producing hpRNA have high stability and efficiency, but the construction of the vector is relatively complicated, and a simple and efficient vector construction method for producing hpRNA needs to be discovered urgently

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • RNAi vector constructed based on isocaudarner and application of RNAi vector
  • RNAi vector constructed based on isocaudarner and application of RNAi vector
  • RNAi vector constructed based on isocaudarner and application of RNAi vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1, RNAi transition vector construction

[0029] Obtaining the second intron sequence (nucleotide sequence shown in SEQ ID NO.1) of rice LOG gene (gene="Os01g0588900"): Design PCR primers LOG-intron-F: (5'GAATTCAAGCTTGGATCCCTCGAGTCAAGGATTTCGGGATGACC) and LOG- Intron-R (5'ACATGGGCCCAGATCTGTCGACTGGTCGCCATGTCA TTGG), using the genome of commercial rice variety Xiushui 134 as a template, was amplified by PCR to obtain a genome fragment with a size of 0.7 kb. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 66°C for 15 seconds, 72°C for 1 minute, repeating 33 cycles; and then 72°C for 10 minutes. Then, clone the fragment into pGEM-T easyVector, save it after sequencing verification, and use it for the next transitional vector construction. The vector was named pGEM-T-LOG-intron. EcoRI, HindIII, BamHI, and XhoI restriction sites are set at the 5' end of the fragments obtained by the above PCR in sequence, among which EcoRI and HindIII are...

Embodiment 2

[0032] Embodiment 2, the construction of the RNAi vector of silencing rice OsTEL gene

[0033] The OsTEL (also named PLASTOCHRON2) gene in rice encodes an RNA-binding protein. Taiji et al. found that the OsTEL gene loss-of-function mutation of rice leaves has an accelerated rate of initial growth, accelerated leaf maturation, and short plants, indicating that it has the function of regulating leaf initiation and maturation (Kawakatsu, (2006) The Plant Cell 18: 612-625; Xiong et al., (2006) Cell Research 16:267-276). However, due to the complete loss of the function of the OsTEL gene in the above mutants, it is impossible to observe the phenotype of the down-regulated expression of the OsTEL gene, and the corresponding relationship between different down-regulation degrees and phenotypes. Therefore, constructing an RNAi vector that silences the OsTEL gene can help us further study the function of the OsTEL gene.

[0034] The acquisition of the target fragment (nucleotide sequ...

Embodiment 3

[0042] Embodiment 3, the construction of the RNAi vector of silencing maize Ms45 gene

[0043] The maize Ms45 gene is specifically expressed in top flowers, and maize plants with loss-of-function mutations in this gene are male sterile (Cigan et al., 2001). Only by constructing an efficient RNAi vector and completely silencing the Ms45 gene can it reach the standard for production use.

[0044] The acquisition of the target fragment (nucleotide sequence shown in SEQ ID NO.6) in the Ms45 gene (GenBank: AF360356.1): design PCR primers MS45-RNAi-F: (5'GGTGCTCGAGCTCTAGATTTAGTAAAAAGGGAGAGAGAGAG) and MS45-RNAi-R ( 5'TGGATCCTGCAGGTTCCTCTTTCTCCATGCTGGTGGAC), using the genome of commercial maize variety Zhengdan 958 as a template, a fragment with a size of 0.4 kb was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 66°C for 15 seconds, 72°C for 30 seconds, repeating 33 cycles; and then 72°C for 10 minutes. Then, clone the fragm...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an RNAi vector constructed based on isocaudarner. The RNAi vector is characterized in that a construction method of the vector comprises a step of transferring a target fragment of a targeting gene to a transition vector, so that the RNAi vector, which is capable of generating hairpin-structure RNA, is constructed. According to the method disclosed by the invention, on the basis of the properties of the isocaudarner, a DNA fragment can be obtained just by implementing PCR amplification once, and the fragment is subjected to enzyme digestion once, so that a construction process is simplified and construction efficiency is improved. Meanwhile, just two isocaudarner restriction enzyme cutting sites are required by the part, where the hairpin structure (target fragment-intron-inverted repeat target fragment) is formed, in the RNAi vector constructed by the method, so that more monoclonal sites are reserved and the flexibility of constructing the vector is enhanced. The RNAi vector, which is constructed by the method, can be widely applied to functional study, genetic modification, molecular breeding and the like of a plurality of species genes; and the RNAi vector has a quite important value on fundamental research and agricultural production.

Description

(1) Technical field [0001] The invention relates to an RNAi carrier, in particular to an RNAi carrier constructed on the basis of the same tail enzyme and its application. (2) Background technology [0002] RNA interference (RNA interference, RNAi) is a sequence-specific post-transcriptional gene silencing ubiquitous in animals and plants triggered by target gene homologous double-stranded RNA (Hannon, (2002) Nature, 418:244-251). It was first discovered in plants and has become an important research method in the post-genome era. RNAi has important application value in plant functional genome, growth and development, anti-virus, quality improvement and so on. [0003] In plants, RNAi is generally achieved by hairpin RNA (hpRNA) having a double-stranded RNA (dsRNA) (Waterhouse and Helliwell, (2003) Nat Rev Genet, 4:29-38). Although antisense RNA-mediated gene silencing has been widely used in plant gene function analysis as an RNAi phenomenon, hpRNA-mediated RNAi has highe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66A01H5/00
CPCC12N15/66C12N15/82C12N15/8218
Inventor 张先文王东芳沈志成
Owner ZHEJIANG UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More