RNAi vector constructed based on isocaudarner and application of RNAi vector
A homologous enzyme and homologous enzyme technology, which is applied in the field of RNAi vectors, can solve the problems of vector construction complexity and achieve the effects of simplifying the construction process, improving construction efficiency, and improving flexibility
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1, RNAi transition vector construction
[0029] Obtaining the second intron sequence (nucleotide sequence shown in SEQ ID NO.1) of rice LOG gene (gene="Os01g0588900"): Design PCR primers LOG-intron-F: (5'GAATTCAAGCTTGGATCCCTCGAGTCAAGGATTTCGGGATGACC) and LOG- Intron-R (5'ACATGGGCCCAGATCTGTCGACTGGTCGCCATGTCA TTGG), using the genome of commercial rice variety Xiushui 134 as a template, was amplified by PCR to obtain a genome fragment with a size of 0.7 kb. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 66°C for 15 seconds, 72°C for 1 minute, repeating 33 cycles; and then 72°C for 10 minutes. Then, clone the fragment into pGEM-T easyVector, save it after sequencing verification, and use it for the next transitional vector construction. The vector was named pGEM-T-LOG-intron. EcoRI, HindIII, BamHI, and XhoI restriction sites are set at the 5' end of the fragments obtained by the above PCR in sequence, among which EcoRI and HindIII are...
Embodiment 2
[0032] Embodiment 2, the construction of the RNAi vector of silencing rice OsTEL gene
[0033] The OsTEL (also named PLASTOCHRON2) gene in rice encodes an RNA-binding protein. Taiji et al. found that the OsTEL gene loss-of-function mutation of rice leaves has an accelerated rate of initial growth, accelerated leaf maturation, and short plants, indicating that it has the function of regulating leaf initiation and maturation (Kawakatsu, (2006) The Plant Cell 18: 612-625; Xiong et al., (2006) Cell Research 16:267-276). However, due to the complete loss of the function of the OsTEL gene in the above mutants, it is impossible to observe the phenotype of the down-regulated expression of the OsTEL gene, and the corresponding relationship between different down-regulation degrees and phenotypes. Therefore, constructing an RNAi vector that silences the OsTEL gene can help us further study the function of the OsTEL gene.
[0034] The acquisition of the target fragment (nucleotide sequ...
Embodiment 3
[0042] Embodiment 3, the construction of the RNAi vector of silencing maize Ms45 gene
[0043] The maize Ms45 gene is specifically expressed in top flowers, and maize plants with loss-of-function mutations in this gene are male sterile (Cigan et al., 2001). Only by constructing an efficient RNAi vector and completely silencing the Ms45 gene can it reach the standard for production use.
[0044] The acquisition of the target fragment (nucleotide sequence shown in SEQ ID NO.6) in the Ms45 gene (GenBank: AF360356.1): design PCR primers MS45-RNAi-F: (5'GGTGCTCGAGCTCTAGATTTAGTAAAAAGGGAGAGAGAGAG) and MS45-RNAi-R ( 5'TGGATCCTGCAGGTTCCTCTTTCTCCATGCTGGTGGAC), using the genome of commercial maize variety Zhengdan 958 as a template, a fragment with a size of 0.4 kb was obtained by PCR amplification. The PCR reaction conditions were: 95°C for 3 minutes; 95°C for 15 seconds, 66°C for 15 seconds, 72°C for 30 seconds, repeating 33 cycles; and then 72°C for 10 minutes. Then, clone the fragm...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
