Bombyx mori silk fibroin heavy chain gene mutant obtained by utilizing CRISPR/Cas technology and mutation method and application
A silkworm, heavy chain technology, applied in genetic engineering, using microinjection method, recombinant DNA technology, etc., can solve the problems of construction difficulty, time-consuming zinc finger nuclease technology, and complicated operation.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0033] The partial nucleotide sequence (base +1201 to +1600) of the silk fibroin heavy chain gene is shown in SEQ ID NO:1.
[0034]Bombyx mori silk fibroin heavy chain gene (gene number AF226688) was obtained from the ncbi database, and Nistari silk fibroin heavy chain genotype was obtained after designing primers to verify the gene sequence. The 20bd sgRNA core sequence was designed using the online software CRISPRdirect, and the synthetic sequences of three base sites (CAAGACGTTCGTTATAACCAcgg, CTCATGAAGACACTTTCCGAtgg, GGGCCATACGTATCAAACAGtgg) were selected in front of +1213~+1236, +1274~1297 and +1349~+1372, respectively adding gaaattaatacgactcactata The T7 promoter sequence, and the fragment gttttagagctagaaatagc complementary to crRNA / tracrRNA, are artificially synthesized as a 62bp front primer, and the back primer crRNA / tracrRNA undergoes PCR procedures to obtain the complete sgRNA sequence, see Figure 1 ~ Figure 3 .
[0035] The reagents used are listed in Table 1.
...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
