Supercharge Your Innovation With Domain-Expert AI Agents!

Method for expressing protein in aspergillus niger resting spores through external-source single strand RNA

A technology of Aspergillus niger spores and dormant spores, applied in the field of protein expression, can solve problems such as inability to apply, and achieve the effects of eliminating cathode effect, avoiding killing cells, and improving cell survival rate.

Inactive Publication Date: 2016-12-21
FUZHOU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Therefore, whether HDEN electroporation technology can be applied to species other than mammalian cells is still unknown.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for expressing protein in aspergillus niger resting spores through external-source single strand RNA
  • Method for expressing protein in aspergillus niger resting spores through external-source single strand RNA
  • Method for expressing protein in aspergillus niger resting spores through external-source single strand RNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0069] Expression of green fluorescent protein (GFP) in Aspergillus niger cells:

[0070] 1. Plasmid construction

[0071] Using the GFP gene coding sequence, the GFP gene is shown in SEQ ID NO.5,

[0072] The protein sequence of the above-mentioned GFP gene is shown in SEQ ID NO.6,

[0073] PCR primers for amplifying GFP gene:

[0074] F: The wavy line is the Aat II restriction site

[0075] R: The wavy line is the Sal I restriction site

[0076] The underlined GCTAGC sequence in primer F is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA. This sequence is next to the initiation codon ATG of the expressed target gene. After the above-mentioned pair of primers are used for PCR, the upstream and downstream of the GFP gene can be carried with GCTAGC, and both upstream and downstream can carry restriction sites.

[0077]

[0078] After the PCR product was detected by agarose gel electrophoresis, the PCR product was recovered a...

Embodiment 2

[0108] Expression of red fluorescent protein (RFP) in Aspergillus niger cells:

[0109] 1. Plasmid construction

[0110] The nucleic acid sequence of RFP is shown in SEQ ID NO. 7,

[0111] The protein sequence of RFP is shown in SEQ ID NO.8,

[0112] The primers used to amplify the RFP gene are as follows:

[0113] Upstream primer: RFP-F: 5'CGGAATTCGCCACCATGGCCTCCTCCGAGGACGT 3'

[0114] Downstream primer: RFP-R: 5'TCGAGCTCGTTAGGCGCCGGTGGAGTGG 3'

[0115] The 5 end of the upstream primer has an EcoR I restriction site, and the underlined GCCACC sequence is used to promote the transcription of the DNA into RNA, and the translation initiation factor binds to the RNA, and this sequence is the initiation codon of the expressed target gene ATG is next to it.

[0116] The 5 end of the downstream primer has a Sal I restriction site.

[0117] According to the method of Example 1, the RFP gene was amplified by PCR, molecular cloning, ligated to pGEM-T easy vector, and then transcribed in vitro, and ...

Embodiment 3

[0133] Yellow fluorescent protein (YFP) expressed in Aspergillus niger cells:

[0134] 1. Plasmid construction

[0135] The nucleic acid sequence of YFP is shown in SEQ ID NO. 9,

[0136] The protein sequence of YFP is shown in SEQ ID NO.10,

[0137] Using the same primers as the GFP in Example 1, and following the same experimental steps and methods, the GFP gene was amplified by PCR for molecular cloning, ligated to pGEM-T easy vector, and transcribed in vitro, and the resulting RNA was transformed Host spores.

[0138] 2. Use yellow fluorescent protein coding RNA to express yellow fluorescent protein in resting spores of Aspergillus niger, the steps are as follows:

[0139] 1) Aspergillus niger culture and spore collection

[0140] In a 15cm petri dish, prepare a solid agar medium (PDA medium), inoculate the surface of the solid agar medium with Aspergillus niger CBS 513.88, incubate for 3 days at a temperature of 40°C and a humidity of 60-85%, and let the surface of the medium grow ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for expressing protein in aspergillus niger resting spores through external-source single strand RNA. The method includes the steps of aspergillus niger cultivating and spore collecting, aspergillus niger spore pretreating and aspergillus-niger-spore electric shocking with the HDEN method; the fungal spore germination step is omitted, the HDEN electro-transformation technology is adopted, extracorporeal single strand encoded protein RNA is sent to penetrate through a cell wall and a cell membrane, and protein is expressed in the aspergillus niger resting spores. The method is simple and quick in step and quite good in effect, and the conversion rate is 90% or above.

Description

Technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a method for expressing proteins in dormant spores of Aspergillus niger by using exogenous single-stranded RNA. Background technique [0002] The central law of molecular biology refers to the transfer of genetic information from DNA to RNA, and then from RNA to protein, which completes the process of transcription and translation of genetic information. In modern genetic engineering, the host is often used to express foreign proteins. The common method is to construct a plasmid vector and place the coding DNA sequence of the foreign protein behind a strong promoter. After it is introduced into the host cell, the coding DNA sequence is transcribed into mRNA. Sequence (single-stranded RNA), mRNA sequence is expressed into protein molecules by the translation machinery in the cell, completing the whole process of foreign protein expression. [0003] DNA can replicate itself stably...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/87C12R1/685
CPCC12N15/87C12N1/14C12N13/00C12N15/90C12N1/145C12R2001/685
Inventor 林峻
Owner FUZHOU UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com