Congenital Immunodeficiency Gene Therapy Vector Construction Method and Application
A kind of gene and application technology, applied in the field of recombinant human interleukin 2 receptor subunit gamma and its expression vector construction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Embodiment 1, SIN-LV-IL2RG construction
[0041] The sequence of the recombinant human interleukin 2 receptor subunit gamma gene (IL2RG) of the present invention is artificially synthesized according to the IL2RG gene sequence (as shown in SEQ ID NO: 1) provided by the GenBank database.
[0042] A method for constructing a lentiviral vector for the recombinant application of the recombinant human interleukin-2 receptor subunit gamma gene, the steps of which include:
[0043] Synthesized human interleukin 2 receptor subunit gamma gene (IL2RG) sequence, designed primers (respectively with BamHI and MfeI restriction sites), IL2RG for: GGTACCGAGCTCGGATCCGC (as shown in SEQ ID NO: 7); IL2RG rev( MfeI): CCCAATTGGCGGGTTTATCACTTATCGTCGTC (shown in SEQ ID NO: 8).
[0044] It was amplified by PCR, and the PCR polymerase used was KOD PLUS (TOYOBO, KOD-201). The reaction system is as follows:
[0045] 10×KOD PLUS buffer: 5 μL;
[0046] dNTPs (2.5mM each): 5μL;
[0047] 25mM ma...
Embodiment 2
[0060] Embodiment 2, verification of SIN-LV-IL2RG
[0061] Positive clones were verified by transfection of 293T cells. After the SIN-LV-IL2RG expression vector was transfected into 293 cells, the total protein was extracted for 48 hours and analyzed by Western Blot. It was found that the expression of SIN-LV-IL2RG (hUbi promoter) was normal ( figure 2 ).
Embodiment 3
[0062] Embodiment 3, the comparison of expression effect of different vectors
[0063] After the SIN-LV-IL2RG expression vectors whose promoters were EF1a promoter, CAG promoter, hUbi promoter and CBh promoter were transfected into 293 cells, the total protein was extracted for 48 hours and analyzed by Western Blot. Compared with the negative control group ( non-transfected vector), IL2RG was expressed in the cells transfected by the SIN-LV-IL2RG expression vector of EF1a promoter, CAG promoter, hUbi promoter and CBh promoter, and the SIN of EF1a promoter and hUbi promoter The expression level of IL2RG in cells transfected with LV-IL2RG expression vector was higher ( Figure 6 ), indicating that the above promoters have a good correlation with the expression of the target gene in the cell, and the protein expression effect is also good.
[0064] In protein expression systems, different vectors are usually required to express different proteins. Mammalian cell expression vect...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com