Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Congenital Immunodeficiency Gene Therapy Vector Construction Method and Application

A kind of gene and application technology, applied in the field of recombinant human interleukin 2 receptor subunit gamma and its expression vector construction

Active Publication Date: 2020-01-17
合肥瑞灵生物科技有限公司
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] However, there is currently no clinical trial report on the application of self-inactivating lentivirus (SIN-LV) to treat X-SCID disease in the world. The present invention designs and uses self-inactivating lentivirus (SIN-LV) to construct IL2RG vector to treat Gene Therapy for Sexual Immunodeficiency Diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Congenital Immunodeficiency Gene Therapy Vector Construction Method and Application
  • Congenital Immunodeficiency Gene Therapy Vector Construction Method and Application
  • Congenital Immunodeficiency Gene Therapy Vector Construction Method and Application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1, SIN-LV-IL2RG construction

[0041] The sequence of the recombinant human interleukin 2 receptor subunit gamma gene (IL2RG) of the present invention is artificially synthesized according to the IL2RG gene sequence (as shown in SEQ ID NO: 1) provided by the GenBank database.

[0042] A method for constructing a lentiviral vector for the recombinant application of the recombinant human interleukin-2 receptor subunit gamma gene, the steps of which include:

[0043] Synthesized human interleukin 2 receptor subunit gamma gene (IL2RG) sequence, designed primers (respectively with BamHI and MfeI restriction sites), IL2RG for: GGTACCGAGCTCGGATCCGC (as shown in SEQ ID NO: 7); IL2RG rev( MfeI): CCCAATTGGCGGGTTTATCACTTATCGTCGTC (shown in SEQ ID NO: 8).

[0044] It was amplified by PCR, and the PCR polymerase used was KOD PLUS (TOYOBO, KOD-201). The reaction system is as follows:

[0045] 10×KOD PLUS buffer: 5 μL;

[0046] dNTPs (2.5mM each): 5μL;

[0047] 25mM ma...

Embodiment 2

[0060] Embodiment 2, verification of SIN-LV-IL2RG

[0061] Positive clones were verified by transfection of 293T cells. After the SIN-LV-IL2RG expression vector was transfected into 293 cells, the total protein was extracted for 48 hours and analyzed by Western Blot. It was found that the expression of SIN-LV-IL2RG (hUbi promoter) was normal ( figure 2 ).

Embodiment 3

[0062] Embodiment 3, the comparison of expression effect of different vectors

[0063] After the SIN-LV-IL2RG expression vectors whose promoters were EF1a promoter, CAG promoter, hUbi promoter and CBh promoter were transfected into 293 cells, the total protein was extracted for 48 hours and analyzed by Western Blot. Compared with the negative control group ( non-transfected vector), IL2RG was expressed in the cells transfected by the SIN-LV-IL2RG expression vector of EF1a promoter, CAG promoter, hUbi promoter and CBh promoter, and the SIN of EF1a promoter and hUbi promoter The expression level of IL2RG in cells transfected with LV-IL2RG expression vector was higher ( Figure 6 ), indicating that the above promoters have a good correlation with the expression of the target gene in the cell, and the protein expression effect is also good.

[0064] In protein expression systems, different vectors are usually required to express different proteins. Mammalian cell expression vect...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

Disclosed are a recombinant lentiviral vector expressing the IL2RG gene, and the preparation thereof, wherein the vector is a self-inactivated third-generation lentiviral vector SIN, and the sequence of the IL2RG gene is as shown in SEQ ID NO: 1. Provided are a method for preparing the vector and the use of the vector in the preparation of a drug for treating primary immunodeficiency diseases.

Description

technical field [0001] The invention relates to a recombinant human interleukin 2 receptor subunit gamma and its expression vector construction method, belonging to the technical field of genetic engineering. Background technique [0002] Immunodeficiency disease (IDD) refers to a disease in which any part of the immune system is abnormal or absent, resulting in immune dysfunction. According to the different pathogenesis of the disease, immunodeficiency disease can be divided into primary immunodeficiency disease (Primary immunodeficiency disease, PIDD) and secondary immunodeficiency disease (Secondary immunodeficiency disease, SIDD). Most of these PIDDs are genetic disorders, and most occur in children under the age of 1. According to different genetic mutations, primary immunodeficiency disease (PIDD) can be subdivided into various subtypes, and more than 300 subtypes including X-linked, autosomal recessive, and autosomal dominant have been reported so far. a genetic dis...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/867A61K48/00A61K38/17A61P37/02
CPCA61K38/1793A61K48/0066C12N15/86C12N2740/15043C12N2800/107Y02A50/30
Inventor 程田林仇子龙郑静
Owner 合肥瑞灵生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com