3'UTR (untranslated region) sequence of specific expression gene in fish germ-line cell and application of 3'UTR sequence
A specific and sequence-based technology, applied in the direction of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve problems that have not been reported yet
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0020] Example 1: Screening of 3'UTR region sequences
[0021] 1. RNA extraction
[0022] Total RNA from flounder testis or ovary was extracted by Trizol (Invitrogen) method, and the specific steps were as follows: Take about 0.1 g of flounder gonads, add 1 mL of Trizol, homogenate with electric motor, leave at room temperature for 5 min, and centrifuge at 12,000 rpm for 5 min. Transfer the supernatant to a new clean centrifuge tube, add 0.2 mL of chloroform, mix gently, and place at room temperature for 15 min. Centrifuge at 12,000 rpm at 4°C for 15 minutes, absorb the upper aqueous phase, and transfer it to another centrifuge tube. Add 0.5ml of isopropanol, mix gently, and place at -20°C for 20min. Centrifuge at 12,000 rpm at 4°C for 10 min, discard the supernatant, and sink the RNA to the bottom of the tube. Add 1 mL of pre-cooled 75% ethanol, shake the centrifuge tube gently, and suspend the precipitate. Centrifuge at 8,000rpm at 4°C for 5min, and discard the supernata...
Embodiment 2
[0039] Example 2: Constructing a recombinant reporter vector for the sequence of the 3'UTR region of the gene
[0040] 1. Construction of gene 3'UTR reporter vector
[0041] 1) Design a pair of PCR primers with restriction endonuclease sites at both ends for the 3'UTR region of the gene, wherein a BamHI and SacI restriction site is added to the 5' and 3' primers for PCR. Its primers are as follows:
[0042] 5'-primer: CGCGGATCCATTGTTCGCTCCACGCA
[0043] 3'-primer: CGAGCTCCTCCTGCTCACTCTGGAAAC
[0044] The PCR reaction program is as follows: pre-denaturation at 95°C for 5 min, denaturation at 95°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 s, cycle 35 times, and extension at 72°C for 10 min to obtain the target fragment by PCR.
[0045] 2) The amplified gene 3'UTR fragment was recovered using the gel recovery kit (TM16090646), connected to the pMD19-T vector, and ampicillin resistance was used to screen positive bacteria with the target fragment.
[0...
Embodiment 3
[0048] Example 3: The 3′-UTR region of the gene with green fluorescence specifically recognizes zebrafish primordial germ cells
[0049] 1. In vitro synthesis of the 3′-UTR mRNA of the gene with green fluorescence
[0050]1) Linearize the reporter carrier obtained in step 4) of Example 2, use KpnI to linearize the carrier, apply the phenol-chloroform method to recover the linearized carrier, and dissolve it with 10ul DEPC water.
[0051] 2) RNA synthesis in vitro
[0052] Use mMESSAGE SP6Kit (Ambion) kit was used to synthesize mRNA in vitro. 2×NTP / CAP10ul, 10×Reaction Buffer 2ul, Linear template DNA 1ug, SP6Enzyme Mix 2ul, add DEPC water to make up to 20ul, mix and spin, react at 37°C for 2h. Add 1ul DNaseI to the reaction system, incubate at 37°C for 15min, and take 1ul to run the gel for detection. Add 115ul of DEPC water and 15ul of NH 4 AC, stop reaction. Add 150ul of chloroform: phenol (1:1) and vortex, centrifuge at 12,000rpm for 1min, take the supernatant and add...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com