Check patentability & draft patents in minutes with Patsnap Eureka AI!

Production process of fusion expression recombinant chicken interferon alpha

A technology for interferon-alpha and production process, which is applied in the field of production process for preparing fusion-expressed recombinant chicken interferon-alpha, can solve the problems of few sources of white blood cells, easy to be removed, and high production cost, and achieve strong antiviral activity, high-efficiency expression and High purification and renaturation efficiency

Inactive Publication Date: 2017-02-15
SOUTH CHINA AGRI UNIV +1
View PDF5 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But its disadvantage is that there are few sources of white blood cells; the induced interferon is a mixture of various subtypes, and the curative effect is average; in addition, there is a risk of virus contamination
The second stage is recombinant interferon. Since the 1980s, the technology of cloning and genetic modification of interferon has been available. Therefore, genetic engineering and recombinant technology are mainly used to produce human interferon in large quantities, and the purity and potency of the product are improved at the same time. However, the recombinant Interferon has a short half-life in the body and is easily eliminated
However, due to the complicated production process of chicken interferon and the high production cost, there are few poultry recombinant interferon products on the market, and the conditions for large-scale clinical application are not yet available.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Production process of fusion expression recombinant chicken interferon alpha
  • Production process of fusion expression recombinant chicken interferon alpha
  • Production process of fusion expression recombinant chicken interferon alpha

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0038] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described here are only used to illustrate and explain the present invention, and are not intended to limit the present invention.

[0039] A production process for preparing fusion expression recombinant chicken interferon alpha, which comprises the following steps:

[0040] S1. According to the codon preference of Escherichia coli, the chicken interferon alpha gene sequence published in Genebank was codon optimized, and the chicken interferon alpha gene was artificially synthesized; the optimized gene was provided by Yingwei Jieji (Shanghai) Trading Co., Ltd. synthesis.

[0041] S2. According to the codon-optimized chicken interferon alpha gene, design three specific primers:

[0042] P1 CGCCATATGTGCAACCATCTGCGCCC;

[0043] P2 CGCGAATTCTCAGGTGCGGGTGTTGCCGG;

[0044] P3 CGCCCATGGATCACAAAGTGCA...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a production process of fusion expression recombinant chicken interferon alpha. The process includes the steps of: S1, according to the preference of Escherichia coli codon, conducting codon optimization on a chicken interferon alpha gene sequence published in Genebank, and artificially synthesizing the chicken interferon alpha gene; S2, according to the codon optimized chicken interferon alpha gene, designing three specific primers; S3, constructing recombinant chicken interferon alpha plasmid containing ProS2 dissolution promoting label; S4, transforming and identifying the recombinant expression plasmid; S5, conducting inducible expression of recombinant chicken interferon alpha; S6, extracting an expression product and conducting protein renaturation purification: S61, inclusion body extraction and treatment; S62, inclusion body denaturation; S63, denaturation solution renaturation; and S64, nickel column affinity purification. By means of cell cytopathic inhibition, the invention detects that the interferon has the activity of inhibiting vesicular stomatitis virus proliferation, and the activity unit reaches 7.32*10<7>UI / mg.

Description

technical field [0001] The invention relates to the technical field of gene recombination, in particular to a production process for preparing and expressing recombinant chicken alpha interferon. Background technique [0002] Interferon is an important member of the body's natural immune system, and its antiviral response is the first line of defense of the natural immune system. When the virus invades, the cells of the body can recognize the virus through the pattern recognition receptors inside and outside the cell, and then activate the natural immune signaling pathway related to interferon, and induce the expression of interferon gene. The expressed interferon can bind to specific receptors on other cells, mediate the transduction of intracellular antiviral signals, and produce antiviral proteins, thereby effectively resisting virus invasion. [0003] Since the discovery of interferon, human beings have made many years and in-depth inventions on the application of inter...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/21C12N15/70C07K14/56
CPCC07K14/56
Inventor 廖明焦培荣吴斯宇冯赛祥孙超孙俭波廖想
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More