Production process of fusion expression recombinant chicken interferon alpha
A technology for interferon-alpha and production process, which is applied in the field of production process for preparing fusion-expressed recombinant chicken interferon-alpha, can solve the problems of few sources of white blood cells, easy to be removed, and high production cost, and achieve strong antiviral activity, high-efficiency expression and High purification and renaturation efficiency
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0038] The preferred embodiments of the present invention will be described below in conjunction with the accompanying drawings. It should be understood that the preferred embodiments described here are only used to illustrate and explain the present invention, and are not intended to limit the present invention.
[0039] A production process for preparing fusion expression recombinant chicken interferon alpha, which comprises the following steps:
[0040] S1. According to the codon preference of Escherichia coli, the chicken interferon alpha gene sequence published in Genebank was codon optimized, and the chicken interferon alpha gene was artificially synthesized; the optimized gene was provided by Yingwei Jieji (Shanghai) Trading Co., Ltd. synthesis.
[0041] S2. According to the codon-optimized chicken interferon alpha gene, design three specific primers:
[0042] P1 CGCCATATGTGCAACCATCTGCGCCC;
[0043] P2 CGCGAATTCTCAGGTGCGGGTGTTGCCGG;
[0044] P3 CGCCCATGGATCACAAAGTGCA...
PUM
Property | Measurement | Unit |
---|---|---|
purity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com