Indel Molecular Marker for Identification of Watermelon Seed Coat Color and Its Primers and Applications

A molecular marker and watermelon technology, applied in the field of molecular biology, can solve the problems that the color of the green seed coat has no effect, and the position and effect of a single gene cannot be determined, so as to speed up cloning and functional verification, improve selection efficiency and accuracy, and speed up The effect of the breeding process

Inactive Publication Date: 2019-05-10
HENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

And these four genes have no effect on green seed coat color
Traditional genetics uses the method of mathematical statistics, which can only study one or more genes controlling the color of the seed coat as a whole, and cannot determine the position and effect of a single gene on the chromosome (Xu Yunbi, 1992)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indel Molecular Marker for Identification of Watermelon Seed Coat Color and Its Primers and Applications
  • Indel Molecular Marker for Identification of Watermelon Seed Coat Color and Its Primers and Applications
  • Indel Molecular Marker for Identification of Watermelon Seed Coat Color and Its Primers and Applications

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The development method of the InDel molecular marker for identifying the color of the watermelon seed coat, the specific steps are as follows:

[0034] (1) Genome-wide QTL mapping for watermelon seed coat color

[0035] F obtained by crossing the female parent "ZXG01478" (jute: yellow seed coat background color, taupe-brown spots) and the male parent "14CB11" (black: black seed coat background color, no cover stripes) 2 The population has constructed a high-density genetic linkage map (Shanget al., 2016), and the parents, F 1 and F 2 Intuitive identification of seed coat color of 93 single melon seeds from the population; Combining genetic linkage map and F 2 The results of population phenotype identification, using the Rqtl-IM-binary method (Yandel et al., 2007) for initial QTL mapping ( figure 1 ), only one major QTL (sc8) for seed coat color was identified in LG8, its peak LOD was 17, which explained 90% of the phenotypic variation, and the corresponding confidenc...

Embodiment 2

[0041] Watermelon F 2 Population molecular marker analysis, comprising the following steps:

[0042] (1) Utilize the CTAB method to extract the total DNA of leaves, the specific steps are as follows:

[0043] ①Put 1g of fresh leaves into a mortar, add liquid nitrogen to grind into powder, then transfer to a centrifuge tube with 1ml of CTAB extraction solution, mix the two thoroughly, and then place them in a constant temperature water bath at 65°C for 60 minutes, during which time they are mixed upside down 2-3 times;

[0044] ②After taking it out from the water bath, centrifuge at 8000rpm for 1min;

[0045] ③Take the supernatant and put it in another centrifuge tube, add an equal volume of chloroform:isoamyl alcohol (24:1, V / V), invert gently to mix well;

[0046] ④Centrifuge at 10000rpm for 5min, take the supernatant (try not to get the middle sediment);

[0047] ⑤ Add 0.7 times the volume of isopropanol (need to pre-cool for 30 minutes in advance), mix well and freeze at ...

Embodiment 3

[0084] f 2 The reconstruction of population genetic linkage map, the steps are as follows: First, use the testa color morphological marker (SC8), the newly developed InDel marker and other SNP markers on LG8 to conduct linkage analysis with Joinmap4.0 software, and find that SC8 is located in the main QTL sc8 The confidence interval of , and it is relatively close to the QTL peak position, the genetic distance between InDel6_sc8 and SC8, one of the newly developed markers, is very close, only 1cM ( figure 2 ). So far, we have developed the co-dominant molecular marker InDel6_sc8 that is most closely linked to the testa color QTL (sc8), which corresponds to a 17bp indel at 22640623bp on chromosome 8, its sequence is ATATGAGCCCGTAGAGG, and its primer sequence is, InDel6_sc8F: AAATCACAGTAATAGAATGCTT ; InDel6_sc8R:TTAGAAGCTACACTCGTCCT. The amplified product of this primer in the female parent (jute) is 197bp, and the amplified product in the male parent (black) is 180bp. The ge...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an InDel molecular marker for authenticating a seed coat color of a watermelon. A nucleotide sequence of the InDel molecular marker is ATATGAGCCCGTAGAGG; primer sequences of the InDel molecular marker are InDel6_sc8F:AAATCACAGTAATAGAATGCTT, and InDe16_sc8R:TTAGAAGCTACACTCGTCCT. The InDel molecular marker closely linked with the seed coat color of the watermelon is prepared, and primers of the InDel molecular marker are designed; the InDel molecular marker is applied to breeding of the seed coat color of the watermelon; a new means can be provided for authenticating the seed coat color of the watermelon; an improvement process of characters of the seed coat color of the watermelon is accelerated; accuracy of breeding and selection efficiency are improved.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to an InDel molecular marker for identifying the color of watermelon seed coats, primers and applications thereof. Background technique [0002] In addition to quality and resistance traits, watermelon seed traits are also one of the goals of breeders in breeding new varieties. The color variation of watermelon seed coat is rich, but there is no uniform description standard, and it is difficult to compare different studies. "Watermelon Germplasm Resources Description Specifications and Data Standards" edited by Ma Shuangwu divides the seed coat background color (first color) into white, yellow-white, gray-yellow, yellow, red-yellow, light red, red, red-brown, taupe, and black There are 12 kinds of green, green and gray-green, and the characteristics of the testa coat (second color) are divided into six types: taupe spots, taupe spots, yellow-white spots, yellow-red spot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12Q1/6895C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor韦小敏李娜尚建立王吉明马双武李楠楠杨雪
OwnerHENAN UNIV OF ANIMAL HUSBANDRY & ECONOMY