538 results about "WATERMELON SEED" patented technology

The invention provides a watermelon seed germination acceleration method. The watermelon seed germination acceleration method comprises the steps of selecting seeds, soaking the seeds with a seed soaking agent, soaking the seeds with a microwave nutrient solution, magnetizing the seeds in a magnetizer, storing the seeds in a refrigerator at varying temperature, conducting seed dressing with rare earth and accelerating germination. According to the watermelon seed germination acceleration method, seed dormancy is broken quickly, the germination rate is increased, root systems of seedlings and watermelon vines are flourishing after seeds processed through the watermelon seed germination acceleration method are planted, the number of plant diseases during the growing period is small, watermelons are high in drought resistance and cold resistance, microelements needed by plants are supplemented, and the quality of the watermelons is improved.

The invention relates to an InDel molecular marker for identifying the watermelon seed size and primers thereof and application of the molecular maker in watermelon seed size breeding. The nucleotide sequence of the InDel molecular marker is TAGCAAGAGCGTTACTACTTCAACTAAAAATATCCATTTCATTTTA, the sequence of the primer InDel14_S6F is TGGTTGTTTCTTTTAGGTGGTA, and the sequence of the primer InDel14_S6R is AGCGATTATGAGCAATTTTA. A major QTL with the thousand seed weight is positioned at a No.6 linkage group through QTL initial positioning, the InDel molecular marker closely linked with the watermelon seed size is prepared by combining parent re-sequencing, the primers of the molecular marker and application of the molecular marker in watermelon seed size breeding are supplied, a new means can be supplied to watermelon seed size breeding, the watermelon seed size character improvement progress is sped up, and the breeding accuracy and selection efficiency are improved.

The invention provides potato staple food cake and a making method thereof. The potato staple food cake comprises, by weight, 20-50 parts of potato flour, 30-80 parts of high gluten flour, 80-240 parts of eggs, 0.1-1.5 parts of baking powder, 0.1-1.8 parts of edible slat; 80-135 parts of white sugar, 1-12 parts of milk powder, 3-10 parts of compound cake emulgator, 10-60 parts of edible oil, 5-35 parts of water, 10-40 parts of dried meat floss and 5-35 parts of watermelon seeds. According to the potato staple food cake, the potato four and whet flour are used cooperatively, compared with cake made of ordinary low-gluten wheat flour, the protein efficiency ratio can be improved, and the content of dietary fiber, vitamins and mineral substances is increased; because the potato flour contains natural phosphate groups, the water absorbing performance and the oil absorbing performance are good, after rehydration, rich natural fragrance is generated, and a smooth taste like bean paste is achieved; in this way, the staple food cake containing the potato flour has the light potato fragrance, compared with the cake made of the ordinary low-gluten wheat flour, the sensory quality is better, and the potato staple food cake is suitable for wide popularization.

The invention discloses large watermelon seeds and a making method thereof. The making method comprises the following steps of: (a) selecting materials, (b) peeling, (c) washing, (d) configuring precooking materials, (e) precooking, (f) configuring boiling materials, (g) enabling the materials to be tasty in a negative pressure manner, (h) drying, (i) stir-frying, (j) polishing, (k) selecting, and (l) packaging to prepare a finished product. The large watermelon seeds made by adopting the method disclosed by the invention are rich in protein, fat, calcium, magnesium, phosphorus, potassium, sodium and other minerals, have the advantages of rich nutrition and crispy and delicious taste, and further become a snack food loved by people; and simultaneously, the method disclosed by the invention is simple to operate and meets the requirements for industrial production.

A watermelon seed treatment method being high in germination rate comprises following steps: (1) pre-treatment of seeds: soaking watermelon seeds in an acidic soaking solution with flat seeds rejected; (2) preparation of a seed soaking liquid: mixing ammonium nitrate, sodium phthalate, sodium humate, an nutrient additive liquid and gibberellins to obtain a mixed aqueous solution; (3) seed soaking: soaking the pre-treated seeds in the seed soaking liquid; (4) sterilization treatment: treating the treated seeds under an infrared light lamp and sowing the seeds after sterilization. In the invention, the seeds are subjected to the pre-treatment so that dormant period of the watermelon seeds is broken, thereby promoting germination of the watermelon seeds. The seed soaking liquid is rich in nutrients so that the watermelon seeds can go through the dormant period with a short time, so that the speed of germination and seedling of the watermelon seeds is increased. The irradiation of the infrared light achieves the sterilization effect and can enhance disease resistance of the seeds, thereby increasing the cultivation successful rate of watermelon and achieving a high germination rate.

The invention discloses a watermelon seed sowing machine. A sowing pipe is connected onto a feeding hopper, a first valve is arranged on the sowing pipe, a first valve rod is glidingly connected in the first valve, the middle of the first valve rod is connected with a first piston, a propping rod is connected onto a swing rod, a first connecting rod is hinged to the swing rod, a movable rod is hinged to the first connecting rod, a pit digging mechanism is connected onto the movable rod, a second cavity is formed in a first roller, a propping block is arranged in the second cavity, a wedge surface is arranged on the propping block, a slide rail is connected onto a rack, a sliding block is arranged in the slide rail, a second connecting rod is hinged to the sliding block, a second roller is arranged on the second connecting rod, a toothed bar is arranged on the rack, meshed with a gear and connected with the slide rail, a water spray pipe is connected onto a water tank, a second valve is arranged on the water spray pipe, a second valve rod is connected in the second valve, a second piston is connected onto the second valve rod, and a third cavity is communicated with the first cavity. Compared with the prior art, the watermelon seed sowing machine has the advantages that the sowing process is simple to operate, the soil humidity is improved, and the germination rate of watermelon seeds is increased.

The invention discloses a biological watermelon seed coating formulation and a preparation method and applications thereof. The biological watermelon seed coating formulation can effectively prevent various soil-borne diseases of watermelon and has the growth-promoting effect on the watermelon, increases the watermelon output remarkably, and meanwhile is free of environment pollution and is low in toxicity and safe. The biological watermelon seed coating formulation is simple in production process, low in production cost, convenient to implement and long in storage period, and is applicable to large-scale industrial production and seed treatment.

The invention provides a solar greenhouse watermelon cultivating method. The solar greenhouse watermelon cultivating method comprises the following steps of (1) selecting a watermelon variety, wherein the watermelon variety suitable for solar greenhouse cultivation is selected; (2) selecting a rootstock variety, wherein the rootstock variety strong in grafting compatibility with the watermelon variety is selected; (3) carrying out land preparation, ridging, drip irrigation hose laying and film mulching; (4) preparing seedling cultivation media, and selecting seedling cultivation containers; (5) carrying out pretreatment on watermelon seeds and rootstock seeds, the seeds are sowed in the containers containing the seedling cultivation media after the seed germination and then are put in the solar greenhouse to be cultivated; (6) carrying out grafting when the watermelon rootstocks grow to be with one leaf and one core and when the leaves of watermelon seedlings are flattened; (7) carrying out field planting when the ground temperature under 10cm is stabilized at higher than 15 DEG C; (8) carrying out field management and harvesting. Through the application of the solar greenhouse watermelon cultivating method, the purposes of producing and supplying water melons in out-of-seasons and prolonging the production industry chain of watermelons can be achieved, the economic benefit is improved and ensured, and the yield and the quality of the watermelons are improved and ensured.

The invention discloses a seedling growing method for watermelons by plug tray seedling growing substrate. Watermelon seeds are stored in environment under 8 to 10 DEG C and with humidity of 60 to 70% for 6 to 8 hours; then the seeds are soaked in seed-soaking reagent for 20 to 30 min; then the soaked seeds are evenly spread in plug tray seedling growing substrate; the seed-soaking reagent comprises following parts by weight of components: 8 to 10 parts of chitosan, 3 to 5 parts of gibberellin, 30 to 40 parts of magnetized water, 3 to 5 parts of carbendazim, 1 to 2 parts of tea saponin, 4 to 6 parts of alanine, 8 to 10 parts of algae micro powder, 4 to 6 parts of capsicum seeds and 3 to 5 parts of potassium dihydrogen phosphate. The plug tray seedling growing substrate of the invention has comprehensive nutrient compositions and balanced proportion, watermelons can be offered with abundant and coordinate nutrition during the whole growth period and the growth of watermelons is effectively promoted, the good quality of watermelons is guaranteed and yield is increased as well as disease resistance of watermelons.

The invention relates to a fish feed. The fish feed comprises the following raw materials in parts by weight: 8-18 parts of corn protein powder, 28-38 parts of straw powder, 10-20 parts of soybean cake powder, 7-11 parts of rice sprout powder, 20-30 parts of rice bran, 2-5 parts of freshwater mussel meat meal, 2-5 parts of earthworm meal, 1-3 parts of leek seeds, 0.5-1.5 parts of lotus flower powder, 0.5-1.5 parts of watermelon seeds, 1-3 parts of shell powder, 1-3 parts of edible salt, 1-3 parts of calcium hydrogen phosphate, 2-6 parts of compound vitamins, 1-2 parts of a traditional Chinese medicine additive, and 1-2 parts of a nutritional seasoning agent. The fish feed disclosed by the invention is green, healthy, rich in nutrition and high in palatability; the added nutritional seasoning agent is capable of improving taste of the feed, as well as accelerating growth rate of the fishes; and the added traditional Chinese medicine additive is capable of enhancing immunity of grass carps, as well as improving disease resistance and antibacterial capacity of the fishes. The fishes fed with the fish feed disclosed by the invention have effectively reduced morbidity and obvious weight gaining, and are active in food intake; moreover, the fish feed is high in feed utilization rate.

The present invention discloses a qi benefiting and blood nourishing fragrant and hot walnut kernel which is made of following raw materials in parts by weight: walnut kernels 80-90 parts, watermelon seed kernels 10-20 parts, fish roes 20-30 parts, corn pollen 7-8 parts, oolong tea 8-10 parts, papaya 8-10 parts, capsicum frutescens 4-5 parts, kadsura longipedunculata 2-2.4 parts, elaeagnus pungens 0.7-1.5 parts, Chinese wolfberry fruits 0.7-2 parts, glycerol, sesbania gum, zein, and an appropriate amount of 3%-4% sodium carbonate aqueous solution. The qi benefiting and blood nourishing fragrant and hot walnut kernel utilizes zein to conduct film coating treatment on walnut kernels, which can completely cut off walnut kernels from the outside moisture and oxygen, inhibit oxidative and rancid process of walnut kernels, and extend the shelf life of walnut kernels; and the added kadsura longipedunculata, elaeagnus pungens and other traditional Chinese medicines increase the health-care efficacies of walnut kernels in clearing liver and improving eyesight, supplementing blood and beautifying features, and calming mind and benefiting qi.

The invention discloses a Chinese herba preparation for treating the diabetes and a preparation method of the Chinese herba preparation. The Chinese herba preparation comprises the following raw medicinal materials: cornus officinalis, radix rehmanniae praeparata, rhizoma anemarrhenae, radix notoginseng, fructus lycii, radix salviae miltiorrhizae, radix angelicae sinensis, radix polygonati officinalis, rhizoma polygonati, radix ophiopogonis, sweet potato, radix asparagi, rhizoma dioscoreae, watermelon seed, rhizoma coptidis, honey-fried licorice root, lotus leaf, schisandra chinensis, duckweed, cortex lycii radicis, clam meal, pollen pini, mulberry, balsam pear, cortex eucommiae, rhodiola rosea and fructus arctii. The Chinese herba preparation realizes the scientific compatibility according to the theory of differential treatment with herbal medicines, has the effects of reducing blood sugar, clearing away heat and toxic materials, enriching yin and nourishing kidney, and conditioning deficiency of spleen and stomach, is high in cure rate, short in course of treatment, low in recurrence rate, and few toxic and side effects, generates relatively good effects on reducing the diabetes and the complications due to the diabetes, and is worth popularization and application.

The invention provides a molecular detection primer of acidovorax avenae subsp. Citrulli and application thereof. The special primer comprises an upstream primer AIT1F: 5'-GCTGGATCACCTCCTTTCTG-3' and a downstream primer AIT2R: 5'-TGACGCAATCAAATTTTTGTCA-3'. Through PCG (Polymerase Chain Reation) amplification and agarose gel electrophoresis, a special amplification product with a fragment length of 462bp can be amplified in pure DNA of the acidovorax avenae subsp. Citrulli, a bacteria carrying disease plant tissue and a seed to rapidly detect the acidovorax avenae subsp. Citrulli. The special detection primer and the application thereof can be used for rapidly, sensitively and specially detecting the acidovorax avenae subsp. Citrulli in bacteria carrying watermelon seeds and plant seeds infected the acidovorax avenae subsp. Citrulli in production practice, can also be used for early diagnosis of field diseases and monitoring and identification of germs and provide a reliable technology and theoretical basis to control diseases caused by the acidovorax avenae subsp. Citrulli.

The invention relates to the field of molecular markers, and provides a method for quickly identifying purity of a watermelon variety Zhentian 1217 by using an EST-SSR (expressed sequence tag-simple sequence repeat) molecular marker. According to the method, a specially designed EST-SSR primer is adopted, a genome DNA of the Zhentian 1217 is used as a template to perform amplification, and a specific band of an amplification result is used for detecting the variety purity of the Zhentian 1217 to be detected. By adopting the method, the identification can be performed at any period of the growth of a Zhentian 1217 plant, and hybrid seeds can be differentiated from female parent selfed seeds and male parent selfed seeds; and the method is high in accuracy and broad in application popularization prospect, and provides a scientific basis for carrying out watermelon seed preparation and selling high-quality seeds timely.

The invention discloses a disinfectant for treating bacterial fruit rot of seedless watermelons and a shell-breaking-free accelerating bud-forcing method for seedless watermelons, wherein the disinfectant contains 2% Kasumin liquid 300-400 fold and 72% agricultural streptomycin sulphate 1000-1500 fold; and the bud-forcing method comprises: soaking seeds in water of 55 DEG C for 30min, then in the disinfectant for 3h, and in formaldehyde 100 fold for 30min after washed; flushing the seeds with saturated limewash until no mucus on seed surfaces, then flushing the seeds with clear water until no peculiar smell, and removing pericarp and wizened seeds; drying until the surfaces of the seeds turn white; wrapping the seeds with cotton cloth, placing the seeds into a thermotank, accelerating germination at 35 DEG C for 2h, and accelerating germination at 32 DEG C for 12-15h; washing the seeds with water of 35 DEG C, drying and dehydrating the seeds, airing the seeds until the surfaces have no obvious water, and waiting for germination in the thermotank of 32 DEG C. The disinfectant and the method can reduce probability for the seedless watermelons to infect bacterial fruit rot below 2 parts per thousand, have no need of artificial shell breaking, can reduce bud-forcing cost of the seedless watermelons, and raises a seedling rate of the seedless watermelon seeds.

The invention relates to a treatment device for increasing the germination rate of watermelon seeds and belongs to the technical field of agricultural tools. The treatment device for increasing the germination rate of watermelon seeds comprises a main body, wherein a seed inlet is formed in the upper side of the main body; a protective cover is arranged at the seed inlet; a baffle is arranged on the protective cover; a slope is arranged on the front side of the seed inlet; a seed storing platform is arranged on the slope; a fence is arranged on the seed storing platform; the main body is internally provided with a power supply control box, a seed airing box and a germination accelerating box. The treatment device is complete in function and convenient to use; the germination rate of the watermelon seeds can be easily, quickly, scientifically, conveniently, intelligently and accurately increased by researchers; the working difficulty of the researchers is relieved.

The invention relates to the technical field of health care food, and concretely relates to a kind of health-care rapeseed oil with functions of nourishing stomach and tonifying kidney. The rapeseed oil is prepared from the following raw materials, by weight, 1300-1400 parts of rapeseeds, 28-30 parts of amygdalus comnnis, 48-52 parts of walnut kernels, 40-45 parts of pumpkin seeds, 12-16 parts of ginger flowers, 18-20 parts of asparagus, 15-18 parts of watermelon seeds, 8-10 parts of white poria, 6-8 parts of psoralea corylifolia, 10-12 parts of licorice and 8-10 parts of sharpleaf galangal fruit. The raw materials of the rapeseed oil contain a plurality of oily plant materials rich in linoleic acid, a plurality of natural Chinese herbal medicine components and health care food of ginger flowers, asparagus and the like are added, and an environmentally-friendly and high-efficiency subcritical carbon dioxide extraction technology is employed. The prepared rapeseed oil has unique flavor, bright and limpid color and luster and comprehensive?nutrition, has health care functions of nourishing stomach, eliminating dampness, rectifying qi, helping digestion, warming kidney, controlling nocturnal emission and the like, and especially is suitable for daily health care of customers with deficiency and cold of spleen and kidney and dyspepsia.

The invention discloses a method for grafting watermelon by utilizing a millstone pumpkin as a stock, which comprises the steps of seed selecting and disinfecting, firstly soaking seeds (millstone pumpkin seeds and watermelon seeds) into a well-prepared water tank filled with two parts of boiled water and one part of cool water, wherein the water temperature after mixing is 60-70 DEG C and the water quantity is five times than the seed quantity; then fully stirring, rinsing the seeds with clean water after the temperature is lowered down to 37 DEG C, later soaking the rinsed seeds in the clean water for 11-12 hours, fishing out and putting the seeds in a constant temperature cabinet for accelerating germination; subsequently earthing up, sowing and grafting, wherein the grafting can be implemented by using a peg graft method, an approach grafting method and a cleft grafting method; after grafting, sprinkling water mist on the second day, photosynthesizing and permanent planting after 20-25 days. The watermelon grafting method is characterized by reducing blight, improving output and controlling survival rate to be over 95 percent.

The invention discloses a method for improving the germination percent and the planting percent of triploid watermelon seeds. In the method, a towel and perlite are used as initiation supporters; after the triploid watermelon seeds and the perlite are fully stirred, water is added; or the triploid watermelon seeds are wrapped by the towel so as to ensure the total water content in the initiation supporters and the triploid watermelon seeds is 60 percent; then the triploid watermelon seeds are initiated in an illumination culture box; the initiation temperature is 20 DEG C and the initiation time is 36 to 48h; under the condition of 20 DEG C after the initiation, the triploid watermelon seeds are re-dried to the original water content, thus being capable of improving the germination percent and the planting percent of the triploid watermelon seeds.

The invention discloses a method for preparing lubricating oil with plant oil as base oil and belongs to the field of lubricating oil. Watermelon seed oil is extracted from watermelon seeds, then the watermelon seed oil is subjected to esterification reaction to obtain watermelon seed grease, and the watermelon seed grease is mixed with vinyl ethyl ether, EDO-86, succinate, triphenyl thiophosphate and other auxiliaries to prepare the lubricating oil. The watermelon seed oil serves as the base oil of the lubricating oil and is subjected to esterification modification, the problem that oxidization performance is poor is solved, the watermelon seed oil is degradable and environmentally friendly, the prepared lubricating oil is good in lubricating performance and high in oxidation resistance, the service life of the engine lubricating oil is prolonged, generation of sediment is reduced, production cost is low, the preparation process is simple, and the method is suitable for industrial production.

The invention discloses a method for extracting watermelon seed oil. The method comprises the following steps: (1) smashing watermelon seeds to obtain watermelon seed powder; (2) mixing the watermelon seed powder with cellulose and water; and (3) adding a mixture obtained in the step (2) into a supercritical carbon dioxide extracting device for extracting to obtain the watermelon seed oil. The method with the combination of enzymolysis and supercritical carbon dioxide extraction has the advantages of convenience, non-toxicity, low temperature, high extraction rate and the like. The obtained watermelon seed oil has high content of unsaturated fatty acid.

The invention relates to the technical field of aquaculture, and specifically relates to a feed capable of increasing yield of carp. The feed is prepared by the following raw materials by weight: 50-55 parts of corn, 20-25 parts of rice hull, 18-20 parts of buckwheat flour, 12-25 parts of fried soybean meal, 8-10 parts of watermelon seeds, 6-8 parts of black bean meal, 8-10 parts of sweet potatoes, 10-12 parts of rapeseed cakes, 5-6 parts of barbary wolfberry fruits, 6-8 parts of lotus powder, 4-5 parts of yellow mealworm meal, 2-3 parts of bone meal, 5-6 parts of luffa flowers, a proper amount of salt and 4-5 parts of a phagostimulant. The prepared carp feed is developed from the omnivorous characteristic of the carp. Raw materials such as the lotus powder, yellow mealworm meal and barbary wolfberry fruits are added, so that nutrients of the feed are supplemented; and palatability of the feed is increased. The carp eats the feed actively; the growth and development of the carp are rapid; weight increase is obvious; and culture yield is obviously increased.

The invention discloses a seedling raising method for watermelons. The method comprises the steps of rootstock preparation, seedling raising preparation, seedbed preparation, seedling raising, management in a sowing period, grafting and management of grafted seedlings. According to the method provided by the invention, watermelon grafting cultivation is performed on the continuous cropping ground,and above operation has the following advantages: 1, an occurrence of blight is effectively prevented; 2, the watermelons can be grown at lower temperature; and 3, a root system of pumpkin rootstockis stronger than that of a watermelon, the grafted seedlings have stronger water absorbing and fertilizer absorbing capacity, and the roots are widely distributed in soil, so that after the watermelons are grafted, fertilizers can be saved, and the yield of the watermelons can be improved; when tissue culture of triploid seedless watermelons is performed, root induction of vegetative propagation seedlings is more difficult, the vegetative propagation seedlings are used as scions to be grafted onto the pumpkin rootstock, so that a shortcoming that seedless watermelon seeds are difficult to reproduce is overcome; when industrialized seedling raising is performed, under the condition of small seeds, branches or buds are grafted onto the rootstock, so that a quantity of the grafted seedlings is greatly increased; and therefore, the method of using pumpkin and gourd as a rootstock and grafting watermelon seedlings is an effective way of development of watermelon planting.

The invention discloses a method for identifying authenticity of watermelon varieties and an SNP (Single Nucleotide Polymorphisms) primer combination special for the method. The SNP primer combinationprovided by the invention consists of 32 primer sets, each primer set consists of 3 primer sequences and is used for amplifying an SNP site, and the nucleotide sequences of the primers in the 32 primer sets are sequentially as shown in a sequence 1 to a sequence 96 in a sequence table. The SNP primer combination provided by the invention can be used for performing early identification on the watermelon varieties at the seed stage or seedling stage, so that the authenticity of the varieties can be guaranteed, the benefits of producers and breeders can be effectively protected, and a technicalsupport can be provided for protecting watermelon seed resources and new varieties. Through the adoption of the method provided by the invention, unknown watermelon varieties can be identified, and the authenticity of the known watermelon varieties can be identified. The method provided by the invention has the advantages of being high in flux, accurate, low in cost, and simple to operate, and saving human resources, and material resources and the like, and has great application prospects.

The invention discloses a method for quickly testing the purity of a hybrid watermelon seed Quankanglvba, and particularly relates to a method for quickly testing the purity of the hybrid watermelon seed Quankanglvba by using an SSR molecular marker, which comprises the following steps: by using an SSR primer QYXG3 or QYXG7, performing amplification and polyacrylamide gel electrophoresis separation on genome DNAs of the watermelon hybrid variety Quankanglvba and parents thereof, thus finding out a key band indicating the difference between a first filial generation and the parents; and calculating the purity of the tested seed to test the Quankanglvba sample, wherein the purity test result is highly consistent with a purity control result identified in field planting. The test method disclosed by the invention can finish seed purity identification within 5 hours, and has the characteristics of being simple and easy to implement, accurate, quick, low in cost and convenient to popularize and the like. The method is applicable to the authentication and variety purity test of the Quankanglvba watermelon hybrid and parents thereof.

The invention discloses health rice bran crude oil. The invention also discloses a preparation method of the health rice bran crude oil. The preparation method comprises the following steps;mixing rice bran, tea seeds, flaxseeds and trichosanthes kirilowii maxim seeds, crushing, mixing with water, and heating so as to obtain a material a; crushing small walnut kernels, pistachio kernels and almonds, adding the crushed materials into the material a, heating and filtering so as to obtain a material b; mixing and preheating kidney beans, black soya beans, soya beans, black sesame, peanuts, watermelon seeds, pumpkin seeds and melon seeds kernels, crushing, mixing with water, heating and adding into the material b so as to obtain a material c; mixing wolfberry fruit, codonopsis pilosula, ginseng, schisandra chinensis, polygonum multiflorum, lysimachia christinae hance, red dates, bighead atractylodes rhizome, the root of red-rooted salvia, radix bupleuri, radix achyranthis bidentatae, rehmannia glutinosa libosch and amomum kravanh shell, crushing, adding into a material c, cooling to room temperature, adjusting the pH value, adding pectinase and cellulase, keeping the temperature so as to obtain a material d, adding isopropanol, leaching, and cooking to room temperature so as to obtain the health rice bran crude oil. According to the invention, the quality of the rice bran oil is enhanced, and meanwhile the medicinal value of the rice bran oil is enhanced.

Tetraploid watermelon inbreds are disclosed. The invention relates to the seeds and plants of the tetraploid watermelon inbreds, the methods of propagating the tetraploid inbreds through seeds and tissue culture. The invention also relates to methods of producing the triploid seedless watermelon seeds and plants by crossing the tetraploid inbreds with diploid watermelon inbreds, and to the triploid plants produced therefrom.

The invention discloses a citrus and watermelon interplanting high-yield cultivation method and relates to the technical field of farming. The method comprises the steps of 1, soil preparation and fertilization; 2, citrus grafting; 3, seedling culture after grafting; 4, citrus seedling field planting; 5, management after citrus seedling field planting; 6, watermelon seed soaking and pregermination; 7, watermelon sowing; 8, management after watermelon sowing; 9, watermelon harvesting; 10, citrus harvesting. By interplanting the field of citrus with watermelon, land utilization rate is increased, the economic income of farmers is increased, and normal growth and harvesting of citrus and watermelon are not affected; meanwhile, watermelon stems can serve as fertilizer of citrus to provide fertility for the growth of citrus, so that the application amount of inorganic fertilizer is reduced and fertilizer investment is reduced.

Tetraploid watermelon inbreds are disclosed. The invention relates to the seeds and plants of the tetraploid watermelon inbreds, the methods of propagating the tetraploid inbreds through seeds and tissue culture. The invention also relates to methods of producing the triploid seedless watermelon seeds and plants by crossing the tetraploid inbreds with diploid watermelon inbreds, and to the triploid plants produced therefrom.