1270 results about "Citrullus lanatus" patented technology

The invention discloses a method for growing watermelons. The method includes the steps of processing seeds and accelerating germination, sowing and raising seedlings, applying base fertilizer on the whole land, transplanting the seedlings, performing field management, harvesting and the like. The method for growing watermelons is easy to operate, convenient to manage, good in growth vigor of watermelons, high in disease resistance, uniform in result nature and high in yield, the yield per mu can reach 4000 kg to 5000 kg, the watermelons are large, good in quality, high in sugar content, bright in flesh color, delicate in flesh and high in water content and commodity value, and therefore the method has great significance for increasing income of melon farmers.

Multiple shoot structures are induced from plant tissues (e.g., shoot apices or axillary buds on an artificial medium) to produce multiple shoot cultures. These multi-shoot cultures are then transformed by known transformation methods. Plants are subsequently regenerated from the transformed cells. Crops that may be efficiently transformed by this method include plants normally recalcitrant to transformation such as sugar beet, sunflower, soybean, cotton, tobacco, tomato, peanuts, melons, watermelon, squash, Brassica, and pepper.

The invention discloses a biocontrol strain for an antagonistic phytopathogen and use thereof. The strain is streptomyces griseoruber Y1B (Streptomyces griseoruber Y1B) CCTCC No:M2013358. The streptomyces griseoruber Y1B is fermented by adopting a GYM culture medium; a fermentation liquor is collected, extracted, and distilled in vacuum, so as to prepare a fermentation crude product. The fermentation crude product has a good antibacterial effect on rhizoctonia solani and watermelon fusarium oxysporum.

The invention belongs to the technical field of agriculture and discloses a watermelon seedling culturing substrate, which comprises the following components: earthworm cast, vermiculite, pearlstone and paclobutrazol, wherein the volume ratio of the earthworm cast to the vermiculite to the pearlstone is (2-3):0.6:0.4; and the dosage of the paclobutrazol is between 10 g / m<3> and 20 g / m<3>. When the substrate is used for culturing watermelon own-rooted seedlings, a nutrient solution does not need to be replenished, the seedlings are in order and strong without growing excessively, and the root systems are developed. After the substrate is planted into soil along with the seedlings, beneficial microorganisms in the substrate can quickly form a dominant microflora around the rooting zone of a crop, so that nutrition elements in the soil can be activated, and the utilization ratio of a fertilizer is increased; the application amount of an inorganic fertilizer can be reduced by 20-30 percent; soil-borne diseases can be resisted effectively, the incidence rate of field blight is low, and the control effect is between 86.74 percent and 89.4 percent, is higher than the control effect of an efficient bactericide for an own-rooted seedling growing from the ordinary substrate, and is basically close to the control effect of a grafted seedling; and the soluble sugar content of watermelon and the yield are increased.

The invention discloses a practical vegetable seedling raising nutritional matrix formula, and belongs to the technical field of plant cultivation. The practical vegetable seedling raising nutritional matrix formula comprises inorganic fertilizer, perlite, roseite, and one or more of turf, fermented vinegar residue, crushed vinegar residue, manioc waste, coconut residuum or plant ash. The nutritional matrix formula is adopted to cultivate cucumbers, watermelons, melons, tomatoes, pepper and broccoli. The organic nutritional matrix formula can meet the requirement on oxygen, nutrition and moisture needed by seedlings to enable the seedlings to be strong. Besides, the formula is simple; raw materials are dominated by organic waste fermentation products, the invention belongs to the recycling of wastes, and the raw materials are all common nutritional matrixes on the market; the compounding is easy to implement; the formula is suitable for seedling testing and researching and large-scale industrialized production of seedlings.

The present invention discloses an active biological drug fertilizer, which is characterized in that: the present invention is prepared with the fermenting process by photosynthetic bacteria, yellow corrupted acid and the extraction from Azadirachtin, Langdu Root and kusnezoff monkshood. The present invention is with an especial function for killing insect and preventing disease as well as accelerating the growth for the plant, protecting flower and fruit, enhancing the output and improving the integrative performance for the product quality and so on. The present invention is adaptable to the crops including rice, wheat, cotton, cole, bean, earthpea, corn, bast fibre plants, watermelon, fruit tree, vegetable, tobacco leaf, tea leaf, medicinal materials, flower, and pasture and seeding wood and so on. Besides, the present invention has also the function for accelerating the output for the pecan. The prevention and cure objects include: lepidopterans, orthopteran, Diptera, Coleoptera, ring vein, Hymenoptera and acarid and so on. The present invention has the much higher sensitivity to the following pests including: prodenia litura, asparagus caterpillar, cabbage butterfly, tea geometrid, tea smaller green leaf hopper, pecan peachblossom maggot and locust and so on.

The invention provides a watermelon grafting method which comprises the following steps of: 1) managing before sowing and grafting a first section of stock pumpkin: selecting seeds, sterilizing the seeds and accelerating germination, configuring nutrient bowls, and managing after sowing; 2) managing before sowing and grafting a second section of stock pumpkin: selecting seeds, sterilizing the seeds and accelerating germination, configuring the nutrient bowls, and managing after sowing; 3) managing before sowing and grafting scion watermelon: selecting seeds, sterilizing the seeds and accelerating germination, configuring the nutrient bowls, and managing after sowing; 4) grafting scion and interstock calabash; 5) grafting the interstock calabash and the first section of stock pumpkin; and 6) managing after grafting: managing temperature, managing illumination, managing sterilization, managing moisture and managing fertilizer. According to the method, the continuous cropping diseases of the watermelon can be effectively resisted, the flavor and quality of the watermelon can be effectively guaranteed, and the economic benefit of watermelon production can be further guaranteed.

The invention discloses a calcium fertilizer and an application thereof. The calcium fertilizer contains water-soluble calcium salt and a plant-growth regulating agent substance. The plant-growth regulating agent substance is amine hexanoate or salts thereof. Regional trials show that, when the calcium fertilizer is sprayed on leaves, the occurrence rate of apple bitter pox disease can be reduced from 27% to below 7%. Compared with simple calcium supplementation products, the calcium fertilizer provided by the invention is advantaged in good calcium supplementation effect and increased yield. The calcium fertilizer provided by the invention assists in promoting plant absorption and transportation of calcium, such that the calcium fertilizer can effectively solve the physiological calcium deficiency problems of fruit trees and vegetables. The calcium fertilizer can also be used for controlling various physiological diseases caused by calcium deficiency, such as apple bitter pox disease, pox blotch, pear blackheart, peach crevice line softening, dehiscent fruits of orange, litchi, longan, mango, dates, and watermelon fruit, umbilical rots of tomatoes and green peppers, cabbage dry heart, and other plant calcium deficiency diseases. With the calcium fertilizer provided by the invention, calcium content in fruits can be improved, the yield can be improved, the fruit quality can be improved, and the storage life can be prolonged.

The invention discloses bacillus subtils 203 for high effectively preventing banana wilt, and the preservation number of the bacillus subtils 203 is CCTCCM207094. The invention simultaneously discloses a process for preparation and usage. The bacillus subtils 203 are obtained after being selected by being cultured face to face on a plate and doing pot experiment, which which is capable of effectively preventing the growth of fusarium oxysporum and has wide antimicrobial spectrum. The invention is also capable of performing antagonistic action on various pathogenic fungi, such as cotton-wilt fusarium, verticillium wilt pathogen, fusarium oxysporum f. sp. niveum, fusarium oxysporum f. sp. lycopersici, curvulavia lunata or colletotrichum musae and the like, which is good in environmental security and good in prospect of development and application.

The invention belongs to the fields of a gene sequence and an obtaining method of the gene sequence, and particularly relates to an obtaining method of an SNP (single nucleotide polymorphism) site and a CAPS (cleaved amplified polymorphic sequence) mark interlocked with a citrullus lanatus fruit bitter taste gene Bt (bitterness). The SNP site and the CAPS mark interlocked with the citrullus lanatus fruit bitter taste have nucleotide base sequences in SEQ ID NO:1-2 in a sequence table. The citrullus lanatus fruit bitter taste gene is primarily positioned by screening a bitter taste single plant in an RILs colony and combining with the high-density genetic map information of the citrullus lanatus; the candidate SNP site interlocked with the character is combined with separate colony verification analysis and natural colony verification analysis; the mark tightly interlocked with a target character is obtained; the SNP site and the CAPS mark can be applied to improvement of citrullus lanatus variety and molecular assisted breeding; a technical support is provided for molecular breeding of the citrullus lanatus quality; and meanwhile, the traditional gene positioning time is greatly shortened.

The invention discloses a method for raising watermelon seedlings by dual-root-cutting grafting. The method mainly takes calabash as a stock and uses a dual root cutting technique and a cutting method to graft watermelon seedlings, and is applicable to areas in middle and lower reaches of Changjiang River. The method mainly comprises the steps of stock seeding, scion seedling, root-cutting grafting, management of root-cutting grafting seedlings, and the like. According to the technique for raising seedlings by dual-root-cutting grafting, the quality of commercial grafted seedlings can be effectively improved, the labor efficiency as well as the yield and quality of watermelons is improved, the production cost is lowered, and the method is a technique for raising the watermelon seedlings by grafting, which is worthy of popularization and capable of replacing traditional grafting methods.

The invention relates to melon and fruit vinegar and a preparation method thereof, which is prepared by washing, peeling, color protecting, smashing and pulping fresh hami melon or water melon, adding various yeasts and various acetic acid strains for mixing and going through the steps of one time fermentation, aging, clarification, blending, sterilization, filling and sterilization. The melon and fruit vinegar of the invention is prepared by adopting fruit vinegar fermented by whole meshed fruit; the adoption of one time fermentation by mixing various microzyme and various acetic acid strains overcomes the disadvantage of the relative weakness of the nutrient contents and flavor substances of the fermentation products owing to the monotonicity of the strain and leads the nutrition composition and flavor substances of the fruit vinegar to be more abundant; meanwhile, in the process of fermentation, by properly supplementing oxygen, the intergrowth of the microzyme and acetic acid bacteria is quick, the fermentation period is short and the efficiency is high; a certain amount of juice is contained in the vinegar, therefore, the nutrition is more abundant and the flavor is better. The melon and fruit vinegar has the advantages of eliminating fatigue, tonifying qi, nourishing the blood, preventing constipation, softening blood vessel, relieving hypertension and decreasing blood fat.

The invention relates to a watermelon seedling culturing substrate and a preparation method, and belongs to the technical field of agricultural seedling culturing. The watermelon seedling culturing substrate comprises the following raw materials of vegetable stubble compost products, grass carbon and vermiculite in a volume ratio of 3-5:1:2, wherein vegetable stubble comprises pepper stubble, cucumber stubble and common head cabbage stubble; and stubble is a plant to a plant tissue left in a field by human after finishing picking. The substrate is most suitable for watermelon seedling culturing; the root activity, the leaf chlorophyll content, strong seedling indicators and the early yield after field planting of cultured watermelon seedlings are superior to those of the watermelon seedlings cultured by using the conventional seedling culturing substrate. The seedling culturing substrate of the invention reduces the using amount of the grass carbon, contributes to saving grass carbon resources, fulfills the aims of resource utilization of the vegetable stubble and reduction of environmental pollution, and has obvious economic benefit, social benefit and ecological benefit.

The invention provides a sticky steamed bun which comprises the raw materials such as flour, flour mixing water and fillings, wherein the flour comprises major ingredients, minor ingredients and auxiliary ingredients; the major ingredients comprise sticky rice flour and glutinous rice flour; the flour mixing water contains purified water and solution stewed by Chinese medicinal herbs or juice of vegetables and juice of fruits; the Chinese medicinal herbs comprise birch tear, tangerine peel and hawthorn; the vegetables comprise rapes, celeries, spinaches, cucumbers, tomatoes, carrots and the like; the fruits comprise apples, hawthorns, oranges, pears, peaches, watermelons and the like; and the volume ratio of the purified water to the solution of Chinese medicinal herbs or the juice of vegetables and the juice of fruits is 1:0.25-0.5. Compared with the prior art, the sticky steamed bun of the invention is not restricted by the seasons and can be eaten all the year round; the types of the fillings are rich; and the components such as the Chinese medicinal herbs, the vegetables and the fruits are better for the digestion and the absorption.

The invention discloses a method for grafting watermelons and cultivating grafted seedlings. The method comprises the following steps of: soaking seeds and accelerating germination: soaking stock seeds and scion seeds with clear water and carrying out moisturizing and germination acceleration for a certain time by a sterilizer; sowing and growing seedlings: horizontally placing and carrying out dibble seeding on the stock seeds subjected to germination acceleration in a nutrition cup, carrying out dibble seeding the scion seeds into a seedling-raising disk and cultivating the scion seeds in a greenhouse, wherein the scion seeds are seeded later than the stock seeds for 7-10 days; grafting: when a first rough leaf of the stock seeds is fully extended and two leaves of the scion seeds do not horizontally extend, grafting scions by adopting a top piece inserting method; and cultivating the grafted seedlings, strictly maintaining certain cultivation conditions and controlling insect pests at regular period. According to the method disclosed by the invention, the grafting survival rate is improved to be over 90 percent. In addition, nutrient soil is prepared from mud in a fish pond as a basic raw material, so that growing quality and grafting survival rate of the stock seedlings, the scion seedlings and the grafted seedlings are effectively improved.

The invention discloses a greenhouse early-maturing watermelon cultivation technique. The technique includes grafting 'early spring ruby', 'early resistance number 1' and 'black beauty' with 'gourd watermelon' (also called rich watermelon, gourd ladle watermelon and north watermelon); cultivating in a seedling bed to be large seedlings prior to transplanting the large seedlings in plastic greenhouse for management; successively harvesting for being on the market after tenth of May. After grafting, watermelons are strong and healthy in root system, strong in growth, high in stress resistance, higher in yield and good in economic benefit.

The invention discloses a mini watermelon grafting and seedlings raising method. The mini watermelon grafting and seedlings raising method comprises the following steps of stock seed selection, stock scion and seeding period, stock scion and grafting combined body, grafting combined body cutting and grafting combined body seedling. The grafting survival rate and the planting percent are improved. The grafting survival rate is more than 98% and the planting percent is more than 95% by means of the method, and the rafting survival rate is about 90% and the planting percent is 75-80% by means of a traditional grafting method. Compared with the traditional grafting method, the grafting survival rate is improved by more than 8%, and the planting percent is improved by 15-20%. A seedling raising period is shortened, namely the seedling raising period in winter and spring is 25-30 days by means of the mini watermelon grafting and seedlings raising method, but the seedling raising period is shortened, namely the seedling raising period in winter and spring is 40-50 days by means of the traditional grafting method, so that the seedling raising period in winter and spring is shortened by 10-20 days by means of the method compared with the traditional grafting method.

A process for preparing organic matrix of fertilizer from the water hyacinth and the stem and leaf of agricultural crops includes breaking, squeezing, solid-liquid separation to obtain solid, natural fermenting or adding EM or CM bacteria for microbial fermenting to obtain organic matrix, and mixing with fermented mushroom dregs or peat to obtain composite organic matrix. Its advantages are high fertilizer and water preservation.

The invention provides an industrial method for extracting natural L-citrulline from plant tissues of watermelons or citrullus lamatus, and the like, which belongs to the technical field of extracting natural products in the food industry and the medicine industry. The watermelons, the citrullus lamtus or the stems and leaves thereof are taken as raw materials, and the extracting process comprises the following steps: firstly, the raw materials are washed clean and broken to separate the watermelon peel from the watermelon pulp for respectively extracting juice; the two juices are mixed, and micro-filtration and ultra-filtration are carried out to remove insoluble substances and macromolecular substances; and then reverse osmosis and nano-filtration are carried out to obtain the filtrate; the pH value of the filtrate is regulated and then a macroporous strong acid cation exchange resin column is added; and then ammonia water is taken as an eluant for isocratic elution; the eluent obtained is decompressed, distilled, deaminized, discolored, condensed and crystallized to obtain a white crystalline product of the natural L-citrulline extracted from the watermelons. The prepared product is a pure natural product without harmful substances and has high purity and good quality, thus the natural L-citrulline can be directly taken as a food additive and raw material of health products or medicines.

The invention relates to the field of pollution-free greenhouse watermelon culture and particularly discloses a growing method for a first batch of greenhouse watermelons and a second to fifth batch of greenhouse watermelons. According to the climate and growing characteristics of the greenhouse watermelons in the Yangtze River basin, fertilizer and pesticides are applied according to different growing periods of the watermelons, so that the watermelons at the different periods fully obtain required nutritional ingredients, stable, full and normal growth is maintained, the yield and the quality of the greenhouse watermelons are improved, and the pollution-free and high-quality greenhouse watermelons are obtained.

The invention discloses a special organic fertilizer for watermelons and a preparation method of the special organic fertilizer, and belongs to the technical field of fertilizers. The special organic fertilizer is prepared from the following raw materials in parts by weight: 30-40 parts of chicken manure, 20-35 parts of decomposed plant straw, 10-15 parts of wheat bran, 10-15 parts of peanut oil residue, 5-10 parts of oil sludge, 5-10 parts of humic acid, 2-5 parts of urea, 10-20 parts of trace elements, 5-10 parts of a complex microbial agent and 5-10 parts a functional microbial agent. The special organic fertilizer can provide abundant nutritive elements for the watermelons according to the growth characteristics of watermelons in various periods, and the special organic fertilizer can increase the yield, improve the quality and character and promote the good growth of watermelons. By using the special organic fertilizer, the use amount of unreasonable fertilizers can be reduced.

A methylotrophic bacillus strain has a preservation number of CGMCC No.10779. The invention further provides the application of the methylotrophic bacillus strain with the CGMCC No.10779 in antagonism phytopathogen, particularly the application in pathogenic bacteria of antagonism anthracnose of ophiopogon japonicus. The methylotrophic bacillus strain provided by the invention has the benefits as follows: 1, the methylotrophic bacillus strain with the CGMCC No.10779 has an antagonistic effect on various plant pathogens such as watermelon fusarium wilt, fusarium wilt of cotton, and helminthosporium maydis, particularly has a very high and efficient antagonistic effect on pathogenic bacteria of anthracnose of ophiopogon japonicus, is classified as an antagonistic strain having high plant disease curing effect and being environmentally friendly and high in biological control, and has an excellent development prospect. 2, the methylotrophic bacillus strain with the CGMCC No.10779 is strong in salt resistance. On the basis that the content of sodium chloride can reach 9 percent, the strain can still grow, is strong in stress-resist ability, is applicable to soil in relatively poor environment, and has a high potential application value.

The invention provides seed and plants of the watermelon line designated TML-EJ00112. The invention thus relates to the plants, seeds and tissue cultures of watermelon line TML-EJ00112, and to methods for producing a watermelon plant produced by crossing a plant of watermelon line TML-EJ00112 with itself or with another watermelon plant, such as a plant of another line. The invention further relates to seeds and plants produced by such crossing. The invention further relates to parts of a plant of watermelon line TML-EJ00112, including the fruits and gametes of such plants.

The invention relates to an InDel molecular marker for identifying the watermelon seed size and primers thereof and application of the molecular maker in watermelon seed size breeding. The nucleotide sequence of the InDel molecular marker is TAGCAAGAGCGTTACTACTTCAACTAAAAATATCCATTTCATTTTA, the sequence of the primer InDel14_S6F is TGGTTGTTTCTTTTAGGTGGTA, and the sequence of the primer InDel14_S6R is AGCGATTATGAGCAATTTTA. A major QTL with the thousand seed weight is positioned at a No.6 linkage group through QTL initial positioning, the InDel molecular marker closely linked with the watermelon seed size is prepared by combining parent re-sequencing, the primers of the molecular marker and application of the molecular marker in watermelon seed size breeding are supplied, a new means can be supplied to watermelon seed size breeding, the watermelon seed size character improvement progress is sped up, and the breeding accuracy and selection efficiency are improved.

The invention discloses a cultivation method for autumn greenhouse watermelons, which comprises the following steps: selecting fine seeds; cultivating strong seedlings; planting; managing the cultivation; performing pest control and the like. According to the cultivation method for the autumn greenhouse watermelons, a high-efficient anti-season special greenhouse watermelons cultivation technique is used for delaying the supply period of the normally open field autumn watermelons from the original second half of October to the days after December for marketing in succession; the technology implementation is simple; the operability is strong; the application is wide; the requirement for the autumn watermelons of the slack season market is met; the plant diseases and insect pests are few during the technical production process; the quality of the acquired autumn watermelons is high.

The invention relates to the field of biotechnology, in particular to application of alternaria alternate metabolic products in cucumber rhizoctonia solani prevention and control. In the invention, endophytic fungus of camphor trees is separated from camphor tree living bodies collected from Tianmu mountain in Hangzhou, Zhejiang province by adopting endophytic fungus separation technology, and isnamed alternaria alternata 31 through microbial taxonomy identification, and the strain is stored in China General Microbiological Culture Collector Center (CGMCCC) on December 31, 2010, and the collection register number is CGMCC No.4508. The invention has a most obvious characteristic that the strain liquid can be fermented to produce active metabolic products which have inhibiting effect on pathogenic bacteria of plant fungus diseases such as Rhizoctonia solani, Fusarium oxysporium, Botrytis cinerea and the like, thus alternaria alternate is an important microbial resource in agriculture.

The invention discloses a greenhouse watermelon and greenhouse broad bean rotation method of facility resource continuous utilization. Watermelon vines are pulled away and a greenhouse is cleaned after greenhouse watermelons are collected from August to October of the first year. Broad bean seeds are directly seeded on or broad bean seedlings after manual vernalization are transplanted on mulching films on two sides of an original drip irrigation zone. Broad bean straws are buried green and returned to fields from May to June of a next year, soil is activated, and soil organic matter is improved. The greenhouse is sealed in July of the next year. Autumn waxy corns are planted in the beginning of August of the next year, and fresh corns are harvested and come into the market in the last ten-day period of October. The corn straws are buried green and left mulching films in the field are cleaned in November of the next year. Watermelon plant facility and watermelon seedlings bed for the next year are prepared in December of the next year. According to different crop rotation time of the greenhouse watermelons, broad bean seeds are directly seeded or broad bean seedlings after the manual vernalization are transplanted for forcing culture, and therefore time of broad bean fresh pods to market can be shifted to earlier time from January to June.

The invention provides Tequila bacillus WM031 collected under number of CCTCC NO:M2016021. The Tequila bacillus can be stably planted in a watermelon plant and can effectively prevent watermelon wilt; when in use, the Tequila bacillus can be prepared into bacterial liquid with bacterial content of 1010 cfu / mL, and root irrigation is performed on watermelon seedlings in field to achieve the objective of preventing watermelon wilt. The Tequila bacillus is high in prevention effect, simple and convenient to use and suitable for large-scale popularization and application.