InDel molecular marker for identifying watermelon seed size and primers and application thereof

A molecular marker and watermelon seed technology, applied in the field of molecular biology, can solve the problems of SNP marker molecular marker-assisted selection, insufficient stability, cumbersome steps, etc., and achieve the effect of improving selection efficiency and accuracy, stable variation, and low cost

Active Publication Date: 2016-06-29
ZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI
View PDF3 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These SNP markers generated based on sequencing cannot be directly used for molecular marker-assisted selection, even if they can be converted into usable markers (such as CAPS / dCAPS), the detection process requires enzyme digestion, high cost, and cumbersome steps
The insertion / deletion (InDel) marker based on whole genome resequencing is a co-dominant marker, which is easy to detect and low in cost, but there are still some unsatisfactory points, such as less variation and insufficient stability, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • InDel molecular marker for identifying watermelon seed size and primers and application thereof
  • InDel molecular marker for identifying watermelon seed size and primers and application thereof
  • InDel molecular marker for identifying watermelon seed size and primers and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] The development method for identifying the InDel molecular marker of watermelon seed size, the specific steps are as follows:

[0038] (1) Preliminary mapping of genome-wide QTL for thousand-grain weight in watermelon

[0039] F obtained by crossing the female parent "ZXG01478" (large grain) and the male parent "14CB11" (small grain) 2 Populations have constructed high-density genetic linkage maps (see figure 1 ), and for parents, F 1 and F 2 The thousand-grain weight phenotype was identified for 93 individual plants in the population; combined with the genetic linkage map and F 2 Population phenotype identification results ( figure 2 ), using WinQTLcartographer2.5software (http: / / statgen.ncsu.edu / qtlcart / WQTLCart.htm) for initial QTL mapping, a thousand-grain weight major QTL (TSW6) was identified in the LG6 linkage group, and its LOD peak value was 46.94, explaining 26.16% of the phenotypic variation, the confidence interval (2-LOD) is 3.68-31.67cM, and the corr...

Embodiment 2

[0045] Watermelon F 2 and RILs population molecular marker analysis, comprising the following steps:

[0046] (1) Extract the total DNA of leaves by CTAB method, the specific steps are as follows:

[0047] Take 1g of fresh leaves and put them into a mortar, add liquid nitrogen to grind them into powder, then transfer them into a centrifuge tube with 1ml of CTAB extraction solution, mix the two thoroughly, then place them in a constant temperature water bath at 65°C for 60 minutes, and mix them upside down for 2 minutes. ~3 times;

[0048] After taking it out from the water bath, centrifuge at 8000rpm for 1min;

[0049] Take the supernatant and put it in another centrifuge tube, add an equal volume of chloroform: isoamyl alcohol (24:1, V / V), invert gently to mix well;

[0050] Centrifuge at 10000rpm for 5min, and take the supernatant (try not to get the middle sediment);

[0051] Add 0.7 times the volume of isopropanol (need to pre-cool for 30 minutes in advance),...

Embodiment 3

[0092] f 2 The population genetic linkage map was reconstructed, and the steps were as follows: Firstly, the thousand-grain weight morphological marker (TSW6) and other SNP markers on LG6 were used for linkage analysis using Joinmap4.0, and it was found that TSW6 was located in the confidence interval of the main effect QTL TSW6, and was basically at the peak position. Among them, the genetic distance to the nearest marker of TSW6 is 6.8cM ( image 3 B). In addition to the newly developed marker InDel14_S6, re-linkage analysis found that the genetic distance between InDel14_S6 and TSW6 is very close, only 1.0cM ( image 3 C). So far, we have developed a molecular marker InDel14_S6 that is closely linked to the thousand-grain weight QTL (TSW6), which corresponds to a 46 bp indel at 5,478,024 bp on chromosome 6. Its sequence is TAGCAAGAGCGTTACTACTTCAACTAAAAATATCCATTTCATTTTA, and its primer sequence is, InDel14_S6F: TGGTTGTTTCTTTAGGTGGTA; InDel14_S6TTGAR: AGCGAAT The amplified...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an InDel molecular marker for identifying the watermelon seed size and primers thereof and application of the molecular maker in watermelon seed size breeding. The nucleotide sequence of the InDel molecular marker is TAGCAAGAGCGTTACTACTTCAACTAAAAATATCCATTTCATTTTA, the sequence of the primer InDel14_S6F is TGGTTGTTTCTTTTAGGTGGTA, and the sequence of the primer InDel14_S6R is AGCGATTATGAGCAATTTTA. A major QTL with the thousand seed weight is positioned at a No.6 linkage group through QTL initial positioning, the InDel molecular marker closely linked with the watermelon seed size is prepared by combining parent re-sequencing, the primers of the molecular marker and application of the molecular marker in watermelon seed size breeding are supplied, a new means can be supplied to watermelon seed size breeding, the watermelon seed size character improvement progress is sped up, and the breeding accuracy and selection efficiency are improved.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to an InDel molecular marker for identifying the size of watermelon seeds, a primer and application thereof. Background technique [0002] The first use of watermelon is to eat fresh, and the pulp is the edible part. The large seeds affect the consumption. Consumers prefer watermelons with no seeds or small seeds. Therefore, small-grained varieties are one of the breeding goals for watermelon cultivation. Another use of watermelon is for seeds, which are the main product of watermelons for seeds. Studies have shown that watermelon seeds for seeds are high-quality protein and vegetable oil resources, and are rich in vitamin D. Therefore, large-grained varieties are the main breeding targets for watermelons for seeds. In the process of resource collection and data collection, the inventors found that the large grains are usually wild watermelons, sticky watermelons and lo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor李娜王吉明马双武尚建立李楠楠杨雪
OwnerZHENGZHOU FRUIT RES INST CHINESE ACADEMY OF AGRI SCI