Preparation method of polyclonal antibody of wheat gliadin TaWG05
A wheat prolamin and polyclonal antibody technology, which can be used in botany equipment and methods, biochemical equipment and methods, chemical instruments and methods, etc., and can solve problems such as wheat allergy
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0057] The wheat γ-glamin TaWG05 polyclonal antibody provided in this application is prepared through the following steps.
[0058] (1) Genomic DNA of wheat variety Zhengmai 004 was extracted;
[0059] Genomic DNA of wheat variety Zhengmai 004 was extracted by using the Plant Genomic DNA Extraction Kit of Tiangen Company and referring to its instructions.
[0060] (2) Design primers: when designing primer sequences, based on the prediction of the bioinformatics software SignalP 4.1 server, the 22 amino acid residues at the N-terminal of wheat γ-gliadin TaWG05 are transit peptides (the prediction results are as follows: figure 1 shown), therefore, when amplifying the target gene corresponding to wheat γ-gliadin TaWG05, the PCR amplification primers for removing its transit peptide were designed as follows:
[0061] Upstream primer: TCGACCCTCGCATCCATGACCAA,
[0062] Downstream primer: TCATTGTCCACCATTGTAGGCG;
[0063] Using the genomic DNA extracted in step (1) as a template, ...
Embodiment 2
[0120] Using the polyclonal antibody against γ-prolamin TaWG05 prepared in Example 1, it is possible to effectively detect whether other wheat varieties (or wheat-containing protein products) contain γ-prolamin TaWG05, so as to detect γ-prolamin TaWG05. Protein TaWG05 allergic people provide effective health guidance, and also provide guidance for the improvement of wheat varieties. Specifically, this example takes some wheat varieties (Xinmai 26, Zhengmai 366, Zhengmai 9023, Aikang 58, Zhengmai 004, Yumai 18, Yanzhan 4110) as examples, and whether they contain γ-alcohol The solubilized protein TaWG05 protein has been detected, and the detection results can lay the foundation for wheat improvement or anti-allergen detection. The specific experimental process is as follows.
[0121] (1) Extract wheat seed protein, the specific steps are as follows:
[0122] (A) Add 200 μL total protein extraction buffer into a 1.5ml centrifuge tube and put it on ice for later use;
[0123] T...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



