Promoter for expressing Aspergillus oryzae glucoamylase, and application thereof
A technology of promoter and strong promoter, applied in the field of genetic engineering, can solve the problems of high viscosity, affecting mass transfer and cell growth, and low utilization rate of cell starch, and achieves the effect of simple and effective method.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0022] Example 1 Construction of recombinant promoter PN5
[0023] According to the upstream and downstream sequences of Aspergillus oryzae glucoamylase promoter PglaA published on NCBI, primers were designed:
[0024]
[0025]
[0026] Use PglaA-1 / PglaA-2 primers to amplify the PglaA promoter sequence, and use five pairs of primers including 97-1-5 to amplify the 97bp core sequence to be concatenated. First, the DNA fragment of the starting promoter PglaA was connected to pMD19-T vector to construct the starting plasmid pMD19-gla-1, which was cut by five sets of double restriction enzymes respectively speI / pmeI, SalI / speI, HindIII / SalI, pmeI / xbaI, xbaI / kpnI , introducing five copies of the target sequence of the promoter to obtain the recombinant plasmid pMD19-gla-2. The introduction of the plasmid is the complete recombinant promoter sequence.
Embodiment 2
[0027] Construction of embodiment 2 glaA gene overexpression vector
[0028] According to the upstream and downstream sequences of the glaA gene in the Aspergillus oryzae genome published on NCBI, primers were designed:
[0029] glaA-1 AAGGAAAAAAGCGGCCGCATGGTGTCTTTCTCTCTTGTCTCC
[0030] glaA-2 GGGGTACC GGCGCGCCGTGTATTGCCGTCATCAGATAATGG
[0031] Using the Aspergillus oryzae genome as a template, the glaA gene was cloned by PCR, the plasmids pMD19-gla-1, pMD19-gla-2 and the target gene were respectively digested with kpn I / NotI, and the recombinant plasmids pMD19-gla-3 and pMD19-gla were constructed by ligation -4.
[0032] Use HindIII / salI to double digest the plasmids pMD19-gla-3, pMD19-gla-4 and the plasmid pbg with the ble resistance gene (pMD19 is used as the vector, connected with Ppgk, ble gene and Tgla), and connect to obtain the recombinant plasmid pMD-P1 and pMD-PN5.
Embodiment 3
[0033] Embodiment 3 Aspergillus oryzae protoplast transforms and the screening of transformants
[0034] After the construction of the plasmid was completed, the target fragment was obtained by double digestion with fast cutting enzyme Asc I / Hind III, and the target DNA was recovered and purified by 1% agarose gel electrophoresis, and used to transform Aspergillus oryzae protoplasts. The method for introducing the target gene into the genome of Aspergillus oryzae is a protoplast transformation method, and the insertion method is random integration. For the protoplast preparation method, see the paper "Metabolic engineering of Aspergillus oryzae NRRL 3488 for increased production of L-malic acid" published in 2013; for the protoplast transformation method, see the paper "Six novel constitutive promoters for metabolic engineering of Aspergillus niger" published in 2013.
[0035] The recombinant plasmid was transformed into Aspergillus oryzae protoplasts, and the positive transfo...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 

