Unlock instant, AI-driven research and patent intelligence for your innovation.

Promoter for expressing Aspergillus oryzae glucoamylase, and application thereof

A technology of promoter and strong promoter, applied in the field of genetic engineering, can solve the problems of high viscosity, affecting mass transfer and cell growth, and low utilization rate of cell starch, and achieves the effect of simple and effective method.

Inactive Publication Date: 2017-04-26
JIANGNAN UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the high viscosity of the starch solution, which affects the mass transfer and bacterial growth during the fermentation process, the industrialization of malic acid production still needs to overcome the technical problem of low bacterial starch utilization.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Promoter for expressing Aspergillus oryzae glucoamylase, and application thereof
  • Promoter for expressing Aspergillus oryzae glucoamylase, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of recombinant promoter PN5

[0023] According to the upstream and downstream sequences of Aspergillus oryzae glucoamylase promoter PglaA published on NCBI, primers were designed:

[0024]

[0025]

[0026] Use PglaA-1 / PglaA-2 primers to amplify the PglaA promoter sequence, and use five pairs of primers including 97-1-5 to amplify the 97bp core sequence to be concatenated. First, the DNA fragment of the starting promoter PglaA was connected to pMD19-T vector to construct the starting plasmid pMD19-gla-1, which was cut by five sets of double restriction enzymes respectively speI / pmeI, SalI / speI, HindIII / SalI, pmeI / xbaI, xbaI / kpnI , introducing five copies of the target sequence of the promoter to obtain the recombinant plasmid pMD19-gla-2. The introduction of the plasmid is the complete recombinant promoter sequence.

Embodiment 2

[0027] Construction of embodiment 2 glaA gene overexpression vector

[0028] According to the upstream and downstream sequences of the glaA gene in the Aspergillus oryzae genome published on NCBI, primers were designed:

[0029] glaA-1 AAGGAAAAAAGCGGCCGCATGGTGTCTTTCTCTCTTGTCTCC

[0030] glaA-2 GGGGTACC GGCGCGCCGTGTATTGCCGTCATCAGATAATGG

[0031] Using the Aspergillus oryzae genome as a template, the glaA gene was cloned by PCR, the plasmids pMD19-gla-1, pMD19-gla-2 and the target gene were respectively digested with kpn I / NotI, and the recombinant plasmids pMD19-gla-3 and pMD19-gla were constructed by ligation -4.

[0032] Use HindIII / salI to double digest the plasmids pMD19-gla-3, pMD19-gla-4 and the plasmid pbg with the ble resistance gene (pMD19 is used as the vector, connected with Ppgk, ble gene and Tgla), and connect to obtain the recombinant plasmid pMD-P1 and pMD-PN5.

Embodiment 3

[0033] Embodiment 3 Aspergillus oryzae protoplast transforms and the screening of transformants

[0034] After the construction of the plasmid was completed, the target fragment was obtained by double digestion with fast cutting enzyme Asc I / Hind III, and the target DNA was recovered and purified by 1% agarose gel electrophoresis, and used to transform Aspergillus oryzae protoplasts. The method for introducing the target gene into the genome of Aspergillus oryzae is a protoplast transformation method, and the insertion method is random integration. For the protoplast preparation method, see the paper "Metabolic engineering of Aspergillus oryzae NRRL 3488 for increased production of L-malic acid" published in 2013; for the protoplast transformation method, see the paper "Six novel constitutive promoters for metabolic engineering of Aspergillus niger" published in 2013.

[0035] The recombinant plasmid was transformed into Aspergillus oryzae protoplasts, and the positive transfo...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a promoter for expressing Aspergillus oryzae glucoamylase, and an application thereof, and belongs to the field of gene engineering. The novel glucoamylase promoter PN5 is constructed through serially connecting the core regions of a glaA promoter. Overexpression of glaA gene is carried out in Aspergillus oryzae under the mediation of an original promoter and a new promoter, and the novel glucoamylase promoter PN5 can be used in starch fermentation to produce L-malic acid. A result shows that the average expression activity and the malic acid output of a recombinant bacterium of the PN5-glaA gene are obviously higher than those of PglaA-glaA gene. A method for reconstructing and applying the promoter is simple and highly-efficient, provides theoretic basis for homologous or heterogenous expression of the target gene in the Aspergillus oryzae, and is of practical production significane to produce the target product through fermenting starch by the Aspergillus oryzae.

Description

technical field [0001] The invention relates to a promoter for expressing Aspergillus oryzae glucoamylase and application thereof, belonging to the field of genetic engineering. Background technique [0002] Aspergillus oryzae, as a "generally regarded as safe" (GRAS) safe strain, has been used in food, feed, acid production, winemaking and other fermentation industries as early as 1,000 years ago, and is an ideal eukaryotic expression vector. Aspergillus oryzae can produce abundant amylases, including glucoamylase, starch hydrolase, glucosidase and so on. At the same time, Aspergillus oryzae can naturally accumulate many intermediate metabolites, such as organic acids and amino acids. Existing technology Through a series of metabolic transformations on the wild-type Aspergillus oryzae NRRL3488, a recombinant strain A. oryzae ma37 was obtained that can ferment glucose and high-yield L-malic acid (disclosed in the invention patent application with application number 20161060...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/80C12N1/15C12P7/46C12R1/69
CPCC12N9/2408C12N15/80C12N2830/34C12P7/46C12Y302/01003
Inventor 刘龙陈坚刘晶晶堵国成李江华房峻
Owner JIANGNAN UNIV