Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Isolation and cloning and function analysis of endogenous bidirectional expression promoter of rice

A bidirectional promoter and promoter technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., to achieve the effect of efficient bidirectional promoter resources

Active Publication Date: 2017-05-17
HUAZHONG AGRI UNIV
View PDF5 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, there are few reports that combine bioinformatics and experimental methods to conduct large-scale screening and identification based on the structural characteristics and expression patterns of bidirectional promoters.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Isolation and cloning and function analysis of endogenous bidirectional expression promoter of rice
  • Isolation and cloning and function analysis of endogenous bidirectional expression promoter of rice
  • Isolation and cloning and function analysis of endogenous bidirectional expression promoter of rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1: Construction of plant expression vector

[0031] Unless otherwise specified, the reference methods and corresponding routine operations of molecular biology listed in this manual can be referred to: [J. Sambrook et al., "Molecular Cloning Experiment Guide (Second Edition)", Chinese translation, Science Press, Beijing , 1996 Edition] related information.

[0032] In the present invention, the candidate bidirectional promoters are firstly selected from the RNA-seq data in the MSU and RAP databases and the expression profile chip data in the CREP database. The selection principles are based on: 1. Gene pairs that are adjacent and have a "head-to-head structure" with opposite transcription directions; 2. In the RNA-seq data, the maximum expression value of the gene pair is higher than 10 at the same time; in the expression profile chip data, the gene pair 3. The expression correlation of gene pairs in the RNA-seq data of 95 samples is higher than 0.4. A grou...

Embodiment 2

[0036] Example 2: Agrobacterium-mediated genetic transformation

[0037] The Agrobacterium-mediated genetic transformation method mainly refers to the method shown in the "Agrobacterium-mediated Genetic Transformation Manual" published by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University (Lin Yongjun et al., 2002). The transformation recipient is the embryogenic callus induced from mature seeds of rice variety Zhonghua 11 (a conventional variety, derived from the Institute of Crop Science, Chinese Academy of Agricultural Sciences). The hygromycin-resistant callus is obtained through precultivation, infection, cocultivation and screening, and then through differentiation, rooting, seedling training and transplanting to obtain transgenic plants. The main steps of the genetic transformation of the present invention, the culture medium and the preparation method thereof are as follows:

[0038] (1) Agrobacterium-mediated genetic transformation...

Embodiment 3

[0136] Embodiment 3: Utilize PCR method to detect transgenic positive plant

[0137] After the transformed seedlings are moved into the greenhouse, wait for them to turn green, then take 1-2cm young leaves from individual plants, extract their genomic DNA, and use the genomic DNA as a template to detect positive plants by PCR. The amplified fragment is a partial fragment of the reporter gene gus, and the fragment size is 699bp. The primer sequences are GUS-F: GGGCGAACAGTTCCTGATTA, GUS-R: AACGTATCCACGCCGTATTC. PCR reaction conditions: 94°C for 5min, 94°C for 50sec, 57°C for 40sec, 72°C for 50sec, 30 cycles, 72°C for 7min. PCR products were detected by 0.8% agarose gel electrophoresis. to all T 0 The generation plants were tested by PCR, and the false positive transformed plants were eliminated according to the test results.

[0138] Genomic DNA was extracted using a small amount of leaf genomic DNA extraction method: take an appropriate amount of young leaves, add 800 μl 1....

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering, and relates to isolation and cloning and function analysis of an endogenous bidirectional expression promoter of rice. A candidate bidirectional promoter BIP1 is selected from a rice genome by combining RNA-seq data in MSU and RAP databases and expression profile chip data in a CREP database, and an experiment proves that the candidate bidirectional promoter BIP1 has bidirectional expression activity; 5' and 3' deletion analysis is carried out, a bidirectional expression control section and a section for controlling the basic expression activity in 5' and 3' directions are identified; and then the conservatism of the BIP1 in gramineous plants is analyzed by using means of bioinformatics. The invention discloses a screening and isolation and cloning method of the bidirectional promoter, a building process of a transformation vector, a genetic transformation process of the rice, a GUS histochemical binding method of a transformation plant, a GUS protein activity detection method, a GFP histological analysis method, a GFP quantitative analysis method and a conservatism analysis method of the bidirectional promoter.

Description

technical field [0001] The invention belongs to the technical field of rice genetic engineering. It specifically relates to the isolation, cloning and functional analysis of rice endogenous bidirectional expression promoters. Background technique [0002] A promoter is a DNA sequence that initiates gene transcription. As an important regulatory element at the transcription level, it can effectively regulate the transcription process of downstream genes under specific time, space and signal stimulation. With the progress of crop genetic improvement and the development of functional genomics research, more and more crop traits have been paid attention to, and more and more candidate genes that can be used for trait improvement have been identified. The efficient application of candidate genes must rely on their specific location , growth period or high-efficiency expression under signal stimulation. Therefore, the diversity of promoters is urgently needed in genetic engineer...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113C12Q1/68
CPCC12N15/113C12N2310/10C12Q1/6895
Inventor 林拥军王睿
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com