Application of OsELF 3 gene in controlling heading stage of paddy rice
A heading date and gene technology, applied in the field of functional verification and cloning of the gene OsELF3, can solve the problems of in-depth research
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0049] Example 1: Isolation and cloning of the OsELF3 gene
[0050] 1. Retrieve the rice mutant library (T 0 generation)
[0051] The oself3 mutant obtained in the present invention (the original number in the rice T-DNA insertion mutant library is: 04Z11ED48) is from the mutant library constructed by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University (Wu et al., Development of enhancertrap lines for functional analysis of the rice genome, Plant Journal, 2003, 35: 418-427; Zhang et al., Non-random distribution of T-DNA insertions at various levels of the genome hierarchy as revealed by analyzing 13,804 T-DNA flanking sequences from an enhancer-trap mutant library, Plant Journal, 2007, 49:947-959). Because in the process of tissue culture, if the retrotransposon in rice is activated, transposition occurs, resulting in insertion mutation. The self3 mutant is a Tos17 tag insertion mutant.
[0052] 2. Search tag flanking sequence database
...
Embodiment 2
[0063] Embodiment 2: RT-PCR verifies the expression pattern of OsELF3 gene
[0064] The present invention uses the reported semi-quantitative RT-PCR (Reverse-transcript PCR) method to analyze the expression pattern of the gene, and the primer ELF3-F (5'GTGGAAATAGTGGGGCATCA 3') used in RT-PCR is located in the first exon (Exon) Above, the primer ELF3-R (5'AGGCGGGAAGTAGTTCATAG 3') is located on the third exon. The product size of the reverse transcription product amplified by ELF3-F+ELF3-R is 994bp. RNA samples were taken from tissues such as roots, stems, leaves, leaf sheaths, shoot tips and young ears at the heading stage. The program of RT-PCR is as follows: denaturation at 94°C for 5min, 45s at 94°C, 45s at 55°C, 28-30cycles at 72°C for 1min, and extension at 72°C for 5min. The detection results of RT-PCR are as follows: Figure 5 shown. Depend on Figure 5 It can be seen that the expression level of OsELF3 gene in the rice root, stem, leaf and leaf sheath at the heading...
Embodiment 3
[0065] Example 3: Functional Verification and Application of OsELF3 Gene
[0066] 1. Construction of Complementary Vectors
[0067] The construction method of the complementary vector pC2301-OsELF3 is as follows: the pCAMBIA2301 vector is used as the backbone vector (purchased from CAMBIA Company, http: / / www.cambia.org / daisy / cambia / materials / overview.html). Digested with SacI to obtain a series of restriction fragments, including the target fragment: Nipponbare BAC clone OSJNBa0014H10 containing the entire OsELF3 gene coding region, and about 1,591 kb before the 5' end and about 370 bp behind the 3' end. Ligate the enzyme-digested fragment with the dephosphorylated vector plasmid pCAMBIA2301 digested by SacI (the endonuclease and alkaline phosphatase used were all purchased from Takara Company, and the ligase was purchased from Promega Company. For specific usage and dosage, refer to this product manual). The ligation product was introduced into Escherichia coli DH10B (purch...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap