Unlock instant, AI-driven research and patent intelligence for your innovation.

Application of OsELF 3 gene in controlling heading stage of paddy rice

A heading date and gene technology, applied in the field of functional verification and cloning of the gene OsELF3, can solve the problems of in-depth research

Inactive Publication Date: 2012-11-14
HUAZHONG AGRI UNIV
View PDF1 Cites 14 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But for rice, which is an important grass crop, because it is a short-day plant, its flowering regulation should be quite different from that of Arabidopsis, and the research at this stage is not in-depth.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of OsELF 3 gene in controlling heading stage of paddy rice
  • Application of OsELF 3 gene in controlling heading stage of paddy rice
  • Application of OsELF 3 gene in controlling heading stage of paddy rice

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0049] Example 1: Isolation and cloning of the OsELF3 gene

[0050] 1. Retrieve the rice mutant library (T 0 generation)

[0051] The oself3 mutant obtained in the present invention (the original number in the rice T-DNA insertion mutant library is: 04Z11ED48) is from the mutant library constructed by the State Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University (Wu et al., Development of enhancertrap lines for functional analysis of the rice genome, Plant Journal, 2003, 35: 418-427; Zhang et al., Non-random distribution of T-DNA insertions at various levels of the genome hierarchy as revealed by analyzing 13,804 T-DNA flanking sequences from an enhancer-trap mutant library, Plant Journal, 2007, 49:947-959). Because in the process of tissue culture, if the retrotransposon in rice is activated, transposition occurs, resulting in insertion mutation. The self3 mutant is a Tos17 tag insertion mutant.

[0052] 2. Search tag flanking sequence database

...

Embodiment 2

[0063] Embodiment 2: RT-PCR verifies the expression pattern of OsELF3 gene

[0064] The present invention uses the reported semi-quantitative RT-PCR (Reverse-transcript PCR) method to analyze the expression pattern of the gene, and the primer ELF3-F (5'GTGGAAATAGTGGGGCATCA 3') used in RT-PCR is located in the first exon (Exon) Above, the primer ELF3-R (5'AGGCGGGAAGTAGTTCATAG 3') is located on the third exon. The product size of the reverse transcription product amplified by ELF3-F+ELF3-R is 994bp. RNA samples were taken from tissues such as roots, stems, leaves, leaf sheaths, shoot tips and young ears at the heading stage. The program of RT-PCR is as follows: denaturation at 94°C for 5min, 45s at 94°C, 45s at 55°C, 28-30cycles at 72°C for 1min, and extension at 72°C for 5min. The detection results of RT-PCR are as follows: Figure 5 shown. Depend on Figure 5 It can be seen that the expression level of OsELF3 gene in the rice root, stem, leaf and leaf sheath at the heading...

Embodiment 3

[0065] Example 3: Functional Verification and Application of OsELF3 Gene

[0066] 1. Construction of Complementary Vectors

[0067] The construction method of the complementary vector pC2301-OsELF3 is as follows: the pCAMBIA2301 vector is used as the backbone vector (purchased from CAMBIA Company, http: / / www.cambia.org / daisy / cambia / materials / overview.html). Digested with SacI to obtain a series of restriction fragments, including the target fragment: Nipponbare BAC clone OSJNBa0014H10 containing the entire OsELF3 gene coding region, and about 1,591 kb before the 5' end and about 370 bp behind the 3' end. Ligate the enzyme-digested fragment with the dephosphorylated vector plasmid pCAMBIA2301 digested by SacI (the endonuclease and alkaline phosphatase used were all purchased from Takara Company, and the ligase was purchased from Promega Company. For specific usage and dosage, refer to this product manual). The ligation product was introduced into Escherichia coli DH10B (purch...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of plant genetic engineering and specifically relates to isolation and cloning and application of OsELF 3 gene capable of controlling the heading stage of paddy rice. According to results of functional complementation experiments of the gene, the OsELF 3 gene has the function of controlling the heading stage of paddy rice, the heading stage of plants can be regulated through improving or weakening the expression level of the OsELF 3 gene by using genetic engineering technology, and therefore, the heading stage of a variety is improved to be adapted to the variety to different areas and seasons. The gene cloned in the invention and coded protein thereof can be extensively used for regulating flowering characteristics of plants and improving growth stages of plant varieties and have critical application values.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering. It specifically relates to the cloning and functional verification of a gene OsELF3 controlling the heading stage of rice, and also relates to the application of the gene in transgenic rice. The invention adopts the method of reverse genetics to search for mutants of candidate genes related to flowering regulation in a rice mutant bank, and clones the rice heading stage control gene OsELF3 through identification of insertion mutant phenotype. Using gene function complementation experiments, it was confirmed that the OsELF3 gene has the function of promoting rice heading under long-day conditions. Overexpression of OsELF3 by means of genetic engineering can cause early heading phenotype in rice, thus confirming that the regulation gene OsELF3 expression level can change the heading date of rice. The invention relates to using the gene or its functional analogue to regulate the heading date...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/29C07K14/415A01H5/00
Inventor 吴昌银杨莹
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More