Unlock instant, AI-driven research and patent intelligence for your innovation.

A novel fusion antigen and its detection kit and application

A technology for fusing antigens and antigens, which is applied in the field of medical detection and diagnosis, and can solve problems such as low sensitivity and poor stability

Active Publication Date: 2020-08-04
SHANGHAI KEHUA BIO ENG
View PDF8 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of these fusion proteins in the expression of HEV antigens is beneficial to increase the expression of antigens, but the sensitivity and stability of the fusion proteins are not high when used in detection reagents.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A novel fusion antigen and its detection kit and application
  • A novel fusion antigen and its detection kit and application
  • A novel fusion antigen and its detection kit and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0069] For example, in a specific embodiment, the preparation method includes:

[0070] (a) connecting the nucleotide sequence encoding the protein fragments of SEQ ID NO: 1 and SEQ ID NO: 2 to a plasmid vector to form a recombinant plasmid;

[0071] (b) transferring the recombinant plasmid in step (a) into a host cell to form a clone cell;

[0072] (c) culturing the cloned daughter cells in step (b) to express the recombinant protein;

[0073] (d) Purification of recombinant protein.

[0074] Immunoassay kit of the present invention

[0075] Based on the fusion protein and fusion antigen of the present invention, those skilled in the art will understand that the fusion protein and fusion antigen of the present invention can be used to prepare corresponding immunoassay kits or immunoassay reagents.

[0076] The immunoassay kit contains the recombinant antigen of the present invention and other reagents for immunoassay. Those skilled in the art will understand that if the t...

Embodiment 1

[0083] Example 1. Construction of a carrier with R fusion protein

[0084]The expression carrier plasmid used in the present invention is pET-28a (+) (Novagen Company), pET-28a (+) is not a necessary expression carrier in the process of implementing the present invention, and many other expression vectors such as pQE32 (Qiagen Company) all Can be used to practice the present invention.

[0085] For the amino acid sequence shown in SEQ ID NO: 1, the codon sequence preferred by Escherichia coli was deduced with biological related software, the NcoI restriction site and 6 His tag sequences CCATGGGCCATCACCACCATCACCAC were added to the front of the sequence, and the BamHI and XhoI restriction sites were added to the end of the sequence Point sequence, a stop codon GGATCCTAACTCGAG is added between the two restriction sites, and the sequence is sent to Sangon Biotechnology for whole gene synthesis.

[0086] The synthesized carrier plasmid containing the target sequence was digested ...

Embodiment 2

[0087] Example 2. Construction of expression plasmids containing HEV fusion antigen genes

[0088] The DNA fragment corresponding to SEQ ID NO: 2 in the gene ORF2 segment of HEV is amplified by PCR, the upstream primer has a BamHI site, the downstream primer has an XhoI site and a stop codon TAA before the XhoI site. After the PCR fragments were recovered and digested, they were respectively connected to the R1 vectors digested by BamHI and XhoI. After cloning, the recombinants were identified by PCR, and the positive clone R1-HEV was obtained. This step can be found in figure 2 .

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a brand new fusion antigen and an immunodetection kit comprising the same. The fusion antigen comprises a fusion protein and a target antigen fragment. The expression quantity of the fusion antigen in cell supernatant is relatively high. The sensitivity and stability of the immunodetection kit prepared by use of the recombinant antigen are remarkably improved.

Description

technical field [0001] The invention belongs to the field of medical detection and diagnosis. Specifically, the present invention relates to a novel fusion antigen, an immunoassay kit containing the fusion antigen and its application. Background technique [0002] Hepatitis E (hepatitis E for short) is also known as intestinally transmitted non-A non-B hepatitis, which is caused by hepatitis E virus (Hepatitis E ViRus, HEV) infection. HEV is rare in Europe and the United States, but it is widely prevalent in the Far East. Nearly 20% of Chinese people have hepatitis E antibodies, which means they have been infected. Pigs and other animals can carry HEV and may be a reservoir of the virus. Pregnant women infected with HEV are seriously ill and prone to liver failure, especially in the third trimester, with a high mortality rate. The morphology and genome structure of HEV are similar to those of calicivirus, and it is mainly transmitted through the digestive tract. During a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K19/00G01N33/68G01N33/569
CPCC07K14/005C07K2319/00C12N2770/28122G01N33/56983G01N33/6854G01N2469/20
Inventor 梁权惠星星王尧李基
Owner SHANGHAI KEHUA BIO ENG