A novel fusion antigen and its detection kit and application
A technology for fusing antigens and antigens, which is applied in the field of medical detection and diagnosis, and can solve problems such as low sensitivity and poor stability
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0069] For example, in a specific embodiment, the preparation method includes:
[0070] (a) connecting the nucleotide sequence encoding the protein fragments of SEQ ID NO: 1 and SEQ ID NO: 2 to a plasmid vector to form a recombinant plasmid;
[0071] (b) transferring the recombinant plasmid in step (a) into a host cell to form a clone cell;
[0072] (c) culturing the cloned daughter cells in step (b) to express the recombinant protein;
[0073] (d) Purification of recombinant protein.
[0074] Immunoassay kit of the present invention
[0075] Based on the fusion protein and fusion antigen of the present invention, those skilled in the art will understand that the fusion protein and fusion antigen of the present invention can be used to prepare corresponding immunoassay kits or immunoassay reagents.
[0076] The immunoassay kit contains the recombinant antigen of the present invention and other reagents for immunoassay. Those skilled in the art will understand that if the t...
Embodiment 1
[0083] Example 1. Construction of a carrier with R fusion protein
[0084]The expression carrier plasmid used in the present invention is pET-28a (+) (Novagen Company), pET-28a (+) is not a necessary expression carrier in the process of implementing the present invention, and many other expression vectors such as pQE32 (Qiagen Company) all Can be used to practice the present invention.
[0085] For the amino acid sequence shown in SEQ ID NO: 1, the codon sequence preferred by Escherichia coli was deduced with biological related software, the NcoI restriction site and 6 His tag sequences CCATGGGCCATCACCACCATCACCAC were added to the front of the sequence, and the BamHI and XhoI restriction sites were added to the end of the sequence Point sequence, a stop codon GGATCCTAACTCGAG is added between the two restriction sites, and the sequence is sent to Sangon Biotechnology for whole gene synthesis.
[0086] The synthesized carrier plasmid containing the target sequence was digested ...
Embodiment 2
[0087] Example 2. Construction of expression plasmids containing HEV fusion antigen genes
[0088] The DNA fragment corresponding to SEQ ID NO: 2 in the gene ORF2 segment of HEV is amplified by PCR, the upstream primer has a BamHI site, the downstream primer has an XhoI site and a stop codon TAA before the XhoI site. After the PCR fragments were recovered and digested, they were respectively connected to the R1 vectors digested by BamHI and XhoI. After cloning, the recombinants were identified by PCR, and the positive clone R1-HEV was obtained. This step can be found in figure 2 .
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


