Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies

A technology of bovine parainfluenza virus and enzyme-linked aptamer, which is applied in the field of bioengineering, can solve the problems of time-consuming laboratory conditions, complicated operation, and time-consuming, and achieve reduced economic losses, good specificity, and high positive detection rate effect

Inactive Publication Date: 2017-05-31
BEIJING UNIV OF AGRI
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Virus neutralization test and fluorescent antibody test are complicated and time-consuming, and are not suitable for rapid diagnosis of large-scale samples; although the hemagglutination inhibition test is simple to operate, it needs to be carried out with BPIV-3 virions as the antigen under the premise of proliferating the virus. Detection is not only time-consuming but also requires high laboratory conditions

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies
  • Indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies
  • Indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] The HN protein solution described in this application is prokaryotically expressed and preserved by our laboratory;

[0047] Nucleic acid aptamer sequence WC-2:

[0048] 5’-BIO-CGGCGCATGCGTCGACCTGCAGCTAGTTAAAGGATAAGCAAGTCGCCGAGGCAACCAATGTGGGATCCGTCGACGAATTCCCTA was synthesized by Shanghai Sangon Bioengineering Co., Ltd. Synthesis method: single tube synthesis 10OD, molar weight 12nmol. When used, dissolve in 200 μL HEPES buffer and incubate at 95°C for 10 min. Rapid ice bath for 10 min and then set aside.

[0049] 1. The indirect competitive enzyme-linked aptamer method for detecting bovine parainfluenza virus type 3 antibodies is as follows:

[0050] Coating: Pipette 100 μL of HN protein solution and coat it in a 96-well ELISA microplate, overnight at 4°C.

[0051] Plate washing: Shake off the coating solution, wash the microwell plate three times with 300 μL HEPEST (HEPES containing 0.05% Tween 20), and spin dry.

[0052] Blocking: Add 200 μL of HEPES solution co...

Embodiment 2

[0080] 1. Determination of optimal HN coating concentration and Bio-WC-2 concentration

[0081] Different concentrations of HN protein were coated on the ELISA plate at 4°C overnight, and 1% BSA was used as the blocking solution. The optimal coating concentration of HN protein and the optimal reaction concentration of nucleic acid aptamer Bio-WC-2 were optimized by I-ELAA test. The results are shown in Table 1, choose OD 450 The value is close to 1 and the condition with the largest P / N value is the optimal condition, that is, the coating concentration of HN protein is 80ug / mL, and the optimum concentration of Bio-WC-2 is 50nM. In this experiment, the amount of Bio-WC-2 added was 100 μL, while the amount of Bio-WC-2 added in Ic-ELAA was 50 μL, then the concentration of Bio-WC-2 in the subsequent Ic-ELAA should be 100 nM.

[0082] Table 1 Determination of optimal HN coating concentration and Bio-WC-2 concentration

[0083]

[0084] 2. Determination of blocking solution

...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an indirect competitive enzyme linked immunosorbent assay aptamer method used for detecting bovine parainfluenza virus 3 antibodies, and belongs to the field of bioengineering. The indirect competitive enzyme linked immunosorbent assay aptamer method comprises following steps: coating; plate washing; blocking; adding of a nucleic acid aptamer and bovine serum; plate washing; adding of second antibodies; color developing; reaction killing; reading; determining of a negative and positive critical value; Ic-ELAA method specific detection; and clinical bovine serum detection. The indirect competitive enzyme linked immunosorbent assay aptamer method is high in specificity; compared with commercially available ELISA kits, the positive detection rate of Ic-ELAA is higher, and is more suitable for clinical serological investigation of bovine parainfluenza virus.

Description

technical field [0001] The invention belongs to the field of bioengineering, and in particular relates to an indirect competitive enzyme-linked aptamer method for detecting bovine parainfluenza virus type 3 antibodies. Background technique [0002] Bovine parainfluenza virus type 3 (BPIV-3), a member of the Paramyxoviridae family and the genus Respirovirus, causes respiratory disease syndrome (BRDC) in cattle and other ruminants. Cattle are prone to infection during transportation and in other stressful environments, showing fever and severe nasal secretions, and even pneumonia, which is the main cause of disease and death in house-fed cattle, causing huge economic losses to the cattle industry . The disease is widely prevalent in the world, and it is also seriously prevalent in most provinces of my country. According to Wang Haiyong's test results on more than a thousand clinical bovine serum samples, the overall positive rate of BPIV-3 antibodies in Chinese cattle herds ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N21/31
CPCG01N33/56983G01N21/31G01N2333/11G01N2469/20
Inventor 王真王家伟鲁琳成杰
Owner BEIJING UNIV OF AGRI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com