Primers for single-tube simultaneous detection of parainfluenza viruses and coronaviruses based on melting curve assay and application of primers

A technology of coronavirus and melting curve, which is applied in the determination/inspection of microorganisms, resistance to vector-borne diseases, biochemical equipment and methods, etc., to achieve the effect of convenient operation, guaranteed accuracy and good stability

Inactive Publication Date: 2017-06-20
CHONGQING DIAN SRAB CENT FOR CLINICAL LAB CO LTD
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a primer and a probe for simultaneously amplifying and detecting a variety of respiratory viruses, so as to solve the problem of repeated experiments for different viruses in the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primers for single-tube simultaneous detection of parainfluenza viruses and coronaviruses based on melting curve assay and application of primers
  • Primers for single-tube simultaneous detection of parainfluenza viruses and coronaviruses based on melting curve assay and application of primers
  • Primers for single-tube simultaneous detection of parainfluenza viruses and coronaviruses based on melting curve assay and application of primers

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: Simultaneously detect the primers and probe sequences of parainfluenza virus types 1 to 3, coronavirus 229E, NL63, OC43, HKU1, synthesized by Yingwei Jieji (Shanghai) Trading Co., Ltd.:

[0062] Reverse transcription primers for reverse transcription:

[0063] Numbering Primer name Sequence (5'-3') corresponding virus SEQ ID NO.1 PIV1-rtp TCTGCACATCCTTGAGTGATTA Parainfluenza virus type 1 SEQ ID NO.2 PIV2-rtp ATCTTCTTTYTCAGARCTTGTAGC Parainfluenza virus type 2 SEQ ID NO.3 PIV3-rtp GCAGTCTCTCTGYGTTTYCC Parainfluenza virus type 3 SEQ ID NO.4 CV229E-rtp GCTAAGGTTGTAKTCACCAAAACT Coronavirus CV229 SEQ ID NO.5 CVNL63-rtp CAAAAGTAGTGTTTATACCAAACTT Coronavirus NL63 SEQ ID NO.6 CVOC43-rtp AAGTTTTGATTACTAACTCCTGGT Coronavirus OC43 SEQ ID NO.7 CVHKU1-rtp AAAAGCAKTAGCTATYAACTTTTGAT Coronavirus HKU1

[0064] The above 7 reverse transcription primers are used together in one dete...

Embodiment 2

[0073] Embodiment 2: sample nucleic acid extraction

[0074] (1) Collection, storage and transportation of clinical specimens: suitable for collection of throat swab specimens. It is advisable to collect in the early morning. Rinse mouth with clean water, assisted by the examiner with a tongue depressor, pass the throat swab over the base of the tongue, reach the lesion in the pharyngeal isthmus, apply it several times, avoid touching the tongue and oral mucosa when taking it out, and swab the swab after sampling Put the swab into about 1mL of normal saline and wash it thoroughly, then squeeze it dry, and discard the cotton swab. The specimens to be tested should not be stored for more than 24 hours at 4°C, and should not be stored for more than 48 hours at -20°C; and not more than three months at -80°C. Specimens should be transported in curlers or foam boxes with ice.

[0075] (2) Extraction of viral RNA: Extraction of viral RNA was carried out according to the instructio...

Embodiment 3

[0076] Example 3: Reverse transcription using the extracted nucleic acid as a template

[0077] (1) Prepare mixed reverse transcription primer working solution:

[0078] Dilute the synthesized reverse transcription primers to 100uM, add 10uL each to a 1.5mL centrifuge tube, add water to 500uL, vortex and mix to obtain the reverse transcription primer working solution.

[0079] (2) Sample viral RNA reverse transcription:

[0080] The total RNA in the sample was reverse-transcribed according to the RevertAid RT Reverse Transcription Kit (Themo, K1691). The reaction system was 10uL, the reverse transcription primer working solution was 0.5ul, other components were added according to the instructions, and finally water was added to 10uL.

[0081] Reaction procedure: 1h at 42°C; 5min at 85°C; store at 4°C.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
melting pointaaaaaaaaaa
Login to View More

Abstract

The invention discloses primers for single-tube simultaneous detection of parainfluenza viruses and coronaviruses based on melting curve assay, and belongs to the technical field of nucleic acid detection. Sequences of reverse transcription primers for detecting various pathogens are shown as SEQ ID NO: 1-7; sequences of tailed specific primers and universal primers are shown as SEQ ID NO: 8-23; and probes include molecular beacon probes which are provided with fluorescence groups and quenching groups, and sequences of the molecular beacon probes are shown as SEQ ID NO: 24-30. According to the method which is capable of simultaneously detecting parainfluenza virus types 1-3 and coronaviruses 229E, NL63, OC43 and HKU1, on the basis of Tem-PCR (target enriched multiplex PCR) technology and melting curve assay, single-tube simultaneous detection of seven respiratory viruses can be achieved by comparing gene sequences of various viruses in a gene sequence library of NCBI and by virtue of the specific primers and the molecular beacon probes which are designed at conserved sites; and the primers are simple to operate and convenient to apply.

Description

technical field [0001] The invention relates to the technical field of nucleic acid detection, in particular to a primer for simultaneously detecting seven respiratory viruses based on a fluorescent probe melting curve method and an application thereof. These 7 viruses include: parainfluenza virus type I (PIV1), parainfluenza virus type II (PIV2), parainfluenza virus III (PIV3), coronavirus 229E (CV229E), coronavirus OC43 (CVOC43), coronavirus NL63 ( CVNL63), coronavirus HKU1 (CVHKU1). Background technique [0002] Acute respiratory infection is one of the most common clinical diseases, which can occur in any gender, age and region, especially in the elderly and infants with high morbidity and mortality, which seriously affects people's health and brings social impact. to serious economic losses. In the 20th century alone, more than 100 million people worldwide died of influenza virus infection. In recent years, bird flu, SARS virus, and A / H1N1 have spread on a large scal...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/70C12Q1/68C12N15/11
CPCC12Q1/686C12Q1/701C12Q2600/16C12Q2527/107C12Q2563/107C12Q2537/143Y02A50/30
Inventor任绪义虞闰六罗英金亚南
OwnerCHONGQING DIAN SRAB CENT FOR CLINICAL LAB CO LTD