Serum miRNA combination-based pulmonary tuberculosis therapeutic effect evaluation kit and applications thereof

A tuberculosis and curative effect evaluation technology, which is applied in the field of disease curative effect evaluation, can solve problems such as easy misdiagnosis, long time-consuming sputum culture inspection, and poor discrimination efficacy, and achieve reliable results, high sensitivity, and strong specificity

Inactive Publication Date: 2017-06-23
李继承
View PDF5 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, empirical judgments based on chest X-ray / CT imaging changes are too subjective, and it is easy to misdiagnose; sputum culture examination takes too long, taking 4-8 weeks, and the resolution is poor, with a specificity of only 57.8%.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Serum miRNA combination-based pulmonary tuberculosis therapeutic effect evaluation kit and applications thereof
  • Serum miRNA combination-based pulmonary tuberculosis therapeutic effect evaluation kit and applications thereof
  • Serum miRNA combination-based pulmonary tuberculosis therapeutic effect evaluation kit and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0074] Embodiment 1: Composition of the tuberculosis curative effect evaluation kit based on serum miRNA composition

[0075] In this embodiment, the pulmonary tuberculosis curative effect evaluation kit includes RNA extraction buffer, poly(A) reaction solution, reverse transcription reaction solution, serum miRNA upstream primer combination, internal reference upstream primer, universal downstream primer and fluorescent quantitative RT-PCR reaction solution; wherein, the serum miRNA composition is composed of 4 differentially expressed serum miRNAs, and the names and sequences of these 4 serum miRNAs are as follows:

[0076] hsa-miR-21-5p: UAGCUUAUCAGACUGAUGUUGA, which is the sequence of SEQ ID NO:1;

[0077] hsa-miR-92a-3p: UAUUGCACUUGUCCCGGCCUGU, which is the sequence of SEQ ID NO:2;

[0078] hsa-miR-125a-5p: UCCCUGAGACCCUUUAACCUGUGA, which is the sequence of SEQ ID NO:3;

[0079] hsa-miR-148b-3p: UCAGUGCAUCACAGAACUUUGU, which is the sequence of SEQ ID NO:,4;

[0080] Th...

Embodiment 2

[0091] Example 2: Establishment of the Logistic stepwise regression model of the pulmonary tuberculosis curative effect evaluation kit

[0092] Tuberculosis curative effect evaluation kit was used to detect hsa-miR-21-5p, hsa-miR-92a-3p, hsa-miR-125a-5p, hsa-miR-125a-5p, Expression levels of hsa-miR-148b-3p.

[0093] (1) Sample collection:

[0094] According to the diagnostic criteria of tuberculosis issued by the Ministry of Health of China, 53 cases of tuberculosis patients without medication, 2 months of treatment and cured tuberculosis patients were collected. During the same period, 53 cases of healthy controls were collected. All HIV tests were negative, no hepatitis B, no diabetes, no asthma, no history of tuberculosis, normal liver and kidney functions, no other congenital diseases, and other diseases such as chronic inflammation and autoimmune diseases were excluded. There was no other operation history, and there was no significant difference in age and gender.

...

Embodiment 3

[0143] Example 3: Verification and application of the detection effect of the pulmonary tuberculosis curative effect evaluation kit

[0144] Leave-one-out cross-validation: take serum samples from cured, 2-month-medicated, drug-naïve pulmonary tuberculosis patients, and healthy controls. Sample collection and detection methods are the same as those described in Example 2.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Sensitivityaaaaaaaaaa
Sensitivityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a serum miRNA combination-based pulmonary tuberculosis therapeutic effect evaluation kit and applications thereof. The kit comprises an RNA extraction buffering solution, a Poly (A)-containing reaction solution, a reverse transcription reaction solution, a serum miRNA upstream primer combination, an internal reference upstream primer, a universal downstream primer and a fluorescent quantitation RT-PCR reaction solution, wherein the serum miRNA upstream primer combination comprises four differentially expressed serum miRNA: hsa-miR-21-5p, hsa-miR-92a-3p, hsa-miR-125a-5p and hsa-miR-148b-3p, the sequences of which are respectively SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4; the internal reference is hsa-miR-16, the sequence of which is SEQ ID NO:5. The detection sensitivity of the kit on treatment of pulmonary tuberculosis is 65.38%, and the specificity is 80.77%, so that the specificity is strong and the sensitivity is high, and the kit has higher accuracy, and is simple and convenient to operate, high in efficiency, small in specimen state limit, and superior to the sputum culture currently clinically adopted, thus providing a new evaluation method for the evaluation on the therapeutic efficacy of pulmonary tuberculosis.

Description

technical field [0001] The invention belongs to the field of disease curative effect evaluation, in particular to a tuberculosis curative effect evaluation kit based on a serum miRNA composition and its application. Background technique [0002] Tuberculosis is a chronic pulmonary infectious disease caused by Mycobacterium tuberculosis infection, which seriously threatens human health, and the epidemic situation in China is very serious. At present, there is no clear evaluation index for the efficacy of pulmonary tuberculosis in my country, resulting in 14% of discharged patients who have not been completely cured; it also leads to overtreatment of another part of patients, resulting in increased drug toxicity, increased economic burden, and waste of medical resources. [0003] At present, the evaluation of the curative effect on tuberculosis is mainly based on the experience judgment of clinicians and sputum culture experiment. However, empirical judgments based on chest X...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6851C12Q1/6883C12Q2600/158C12Q2600/178C12Q2521/107C12Q2531/113C12Q2545/101C12Q2563/107
Inventor李继承王冲
Owner李继承