Identification method and application of petunia anther early specific expression promoter pPhGRP
A morning glory and promoter technology, applied in the field of plant genetic engineering, can solve the problems of gene silencing, consumption of material and energy, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0023] Embodiment 1: Expression analysis of PhGRP gene
[0024] ①Petunia RNA extraction
[0025]Petunia RNA was extracted by liquid nitrogen grinding method (refer to Huang et al. 2015 for specific methods), and the EASYspin Plant RNA Kit used was purchased from Beijing Aidelai Company. RNA was extracted from flower buds of 8 different developmental stages (0.2bud, 0.3bud, 0.5bud, 1.0bud, 1.5bud, 2.0bud, 2.5bud, 3.5bud were obtained from the flower buds whose heights were 2mm, 3mm, 5mm, and 10mm after removing the calyx, respectively. , 15mm, 20mm, 25mm, 35mm flower buds), roots, stems, leaves, open flowers and anthers in flower buds of 8 different developmental stages.
[0026] ②Reverse transcription to synthesize first-strand cDNA
[0027] Use the one-step kit of Beijing Quanshijin Biotechnology Co., Ltd. to synthesize the first-strand cDNA of each tissue of petunia. This method can remove the remaining genomic DNA in the RNA template while synthesizing the first-strand cD...
Embodiment 2
[0038] Example 2: Cloning of promoter pPhGRP
[0039] ① Petunia Genomic DNA Extraction
[0040] Petunia DNA was extracted using the conventional CTAB method, and the specific operation method was reported by Huang et al.2015.
[0041] ② Acquisition of promoter pPhGRP sequence
[0042] Use Primer 5 software to carry out the design of primer, the primer sequence that is used to amplify this promoter is as follows:
[0043] pPhGRPF:GAAATGTTGTCATCACCCTCA,
[0044] pPhGRPR:TTTCTTCAATAGCAGTACTTGAGAG;
[0045] PCR reaction system: 10×buffer 2μl; dNTP 0.4μl; upstream and downstream primers 0.2μM; Taq polymerase 0.2μl, add ddH 2 O make up to 20μl system.
[0046] PCR program: 94°C pre-denaturation for 3min; 94°C for 30sec, 55°C for 30sec, 72°C for 1min, 28 cycles; 72°C for 7min.
[0047] Through PCR cloning, we successfully obtained the promoter of the PhGRP gene with a length of 1220 bp. We named the promoter of the gene pPhGRP, and the nucleotide sequence of the promoter is sho...
Embodiment 3
[0048] Example 3: Transformation of Arabidopsis thaliana with the promoter expression vector pPhGRP::GUS vector
[0049] ①Construction of expression vector pPhGRP::GUS
[0050] The expression vector pPhGRP::GUS was constructed by inserting the promoter pPhGRP into the plasmid pCAMBIA1391Z containing the GUS gene. Use Primer Premier 5 software to design primers, perform PCR reaction, recover target fragments and perform BP reaction, then transform Escherichia coli competent cells DH5α by heat shock method, and pick full colonies for PCR detection.
[0051] Primer sequence:
[0052] pPhGRPF:GAAATGTTGTCATCACCCTCA,
[0053] GUS-R: TTTTTGTCACGCGCTATCAG;
[0054] PCR reaction system: 10×buffer 2μl; dNTP 0.4μl; upstream and downstream primers 0.2μl; Taq polymerase 0.2μl, add ddH 2 O make up to 20μl system.
[0055] PCR reaction program: 94°C pre-denaturation for 3 minutes; 94°C for 30sec, 55°C for 30sec, 72°C for 1min, 25 cycles; 72°C extension for 7min.
[0056] Pick positive ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



