Check patentability & draft patents in minutes with Patsnap Eureka AI!

Identification method and application of petunia anther early specific expression promoter pPhGRP

A morning glory and promoter technology, applied in the field of plant genetic engineering, can solve the problems of gene silencing, consumption of material and energy, etc.

Inactive Publication Date: 2017-07-25
HUAZHONG AGRI UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Constitutive promoters can regulate the constant expression of downstream genes in different tissues and at different time periods. Now the cauliflower mosaic virus promoter (CaMV35S) is more commonly used, but this promoter will continue to drive the target gene in various plant tissues. Overexpression in plants consumes excessive material and energy in plants, and causes a series of unfavorable results (Gittins et al 2000). In addition, it was also found that gene silencing was caused by constitutive overexpression of the target gene (Kumpatla et al 1998)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Identification method and application of petunia anther early specific expression promoter pPhGRP
  • Identification method and application of petunia anther early specific expression promoter pPhGRP
  • Identification method and application of petunia anther early specific expression promoter pPhGRP

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Embodiment 1: Expression analysis of PhGRP gene

[0024] ①Petunia RNA extraction

[0025]Petunia RNA was extracted by liquid nitrogen grinding method (refer to Huang et al. 2015 for specific methods), and the EASYspin Plant RNA Kit used was purchased from Beijing Aidelai Company. RNA was extracted from flower buds of 8 different developmental stages (0.2bud, 0.3bud, 0.5bud, 1.0bud, 1.5bud, 2.0bud, 2.5bud, 3.5bud were obtained from the flower buds whose heights were 2mm, 3mm, 5mm, and 10mm after removing the calyx, respectively. , 15mm, 20mm, 25mm, 35mm flower buds), roots, stems, leaves, open flowers and anthers in flower buds of 8 different developmental stages.

[0026] ②Reverse transcription to synthesize first-strand cDNA

[0027] Use the one-step kit of Beijing Quanshijin Biotechnology Co., Ltd. to synthesize the first-strand cDNA of each tissue of petunia. This method can remove the remaining genomic DNA in the RNA template while synthesizing the first-strand cD...

Embodiment 2

[0038] Example 2: Cloning of promoter pPhGRP

[0039] ① Petunia Genomic DNA Extraction

[0040] Petunia DNA was extracted using the conventional CTAB method, and the specific operation method was reported by Huang et al.2015.

[0041] ② Acquisition of promoter pPhGRP sequence

[0042] Use Primer 5 software to carry out the design of primer, the primer sequence that is used to amplify this promoter is as follows:

[0043] pPhGRPF:GAAATGTTGTCATCACCCTCA,

[0044] pPhGRPR:TTTCTTCAATAGCAGTACTTGAGAG;

[0045] PCR reaction system: 10×buffer 2μl; dNTP 0.4μl; upstream and downstream primers 0.2μM; Taq polymerase 0.2μl, add ddH 2 O make up to 20μl system.

[0046] PCR program: 94°C pre-denaturation for 3min; 94°C for 30sec, 55°C for 30sec, 72°C for 1min, 28 cycles; 72°C for 7min.

[0047] Through PCR cloning, we successfully obtained the promoter of the PhGRP gene with a length of 1220 bp. We named the promoter of the gene pPhGRP, and the nucleotide sequence of the promoter is sho...

Embodiment 3

[0048] Example 3: Transformation of Arabidopsis thaliana with the promoter expression vector pPhGRP::GUS vector

[0049] ①Construction of expression vector pPhGRP::GUS

[0050] The expression vector pPhGRP::GUS was constructed by inserting the promoter pPhGRP into the plasmid pCAMBIA1391Z containing the GUS gene. Use Primer Premier 5 software to design primers, perform PCR reaction, recover target fragments and perform BP reaction, then transform Escherichia coli competent cells DH5α by heat shock method, and pick full colonies for PCR detection.

[0051] Primer sequence:

[0052] pPhGRPF:GAAATGTTGTCATCACCCTCA,

[0053] GUS-R: TTTTTGTCACGCGCTATCAG;

[0054] PCR reaction system: 10×buffer 2μl; dNTP 0.4μl; upstream and downstream primers 0.2μl; Taq polymerase 0.2μl, add ddH 2 O make up to 20μl system.

[0055] PCR reaction program: 94°C pre-denaturation for 3 minutes; 94°C for 30sec, 55°C for 30sec, 72°C for 1min, 25 cycles; 72°C extension for 7min.

[0056] Pick positive ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of plant genetic engineering and relates to an identification method and application of a petunia anther development early specific expression promoter pPhGRP. The separated promoter has a nucleotide sequence shown in the formula of SEQ ID NO: 1. A result of a quantitative PCR test on a promoter-driven petunia endogenous gene shows that the promoter-driven gene only is specifically expressed in the anther development early stage and is not expressed in other stages or in other tissues. The biological function verification and GUS staining detection results show that the promoter pPhGRP-driven reporter gene is not expressed in root, leaves and silique of arabidopsis thaliana and only is specifically expressed in the anther. The promoter pPhGRP-driven toxin gene Barnase only is specifically expressed in the petunia anther and is not expressed in other stages or in other tissues so that the male sterile line having other normally developed organs is obtained. The promoter can be used for male sterility genetic engineering, anther development regulation and control, and heterosis utilization.

Description

technical field [0001] The invention belongs to the technical field of plant genetic engineering, and in particular relates to the identification and application of a petunia anther early specific expression promoter pPhGRP. Isolate and clone an anther early-specific expression promoter from petunia plants, and apply it to construct a specific expression vector, which can specifically express specific genes in anthers to regulate anther development and create genetically engineered males CMS and other purposes. Background technique [0002] The expression of a gene is mainly regulated at the transcriptional level, and its upstream promoter (promoter) and transcription factor (transcription factor) combine to determine the transcriptional expression of the gene. Promoters can generally be divided into three types: constitutive promoters, inducible promoters, and tissue-specific promoters. Constitutive promoters can regulate the constant expression of downstream genes in dif...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/113
CPCC12N15/8233C12N15/8287C12N15/8289
Inventor 胡惠蓉田绍泽岳远征刘思禹马慧汪昱乔殷超群郭芮彭昊杨赵楠
Owner HUAZHONG AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More