Versicolorin A nucleic acid aptamer and application thereof
A technology of aspergillus nucleic acid and aspergillus versicolor, which is applied in the detection field, can solve the problems of long detection time, single detection technology, complex detection scheme, etc., and achieves the effects of fast processing speed, simplified modification process and low use cost.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Embodiment 1: Ver A nucleic acid aptamer of the present invention
[0035] The Ver A nucleic acid aptamers shown in Table 1 below were chemically synthesized, and these nucleic acid sequences were all single-stranded DNAs with a length of 49 bp.
[0036] Table 1
[0037]
[0038]
[0039]As shown in the above table, all Aspergillus versicolor aptamers include a core sequence with the sequence of SEQ ID NO.1, the core sequence is 37 bases, and nucleic acid bases are randomly introduced at both ends of the core sequence. SEQ ID NO. 1: TTGGGCACGTCCAAGCCGCACATTTCTCGTGCCCTTC
[0040] Amino modification is carried out at the 3' end of the nucleic acid aptamers listed in Table 1 to obtain VerA-aptamar3'-(CH 2 ) 6 -NH 2 -, used in the following examples.
Embodiment 2
[0041] Example 2: Construction of Ver A Aptamer Affinity SPE Cartridge
[0042] (1) Reagents and instruments
[0043] Versicolor A (Ver A, prepared by our laboratory, with a purity of 99.96%).
[0044] Na 2 HPO 4 12H 2 O, C 6 h 8 o 7 ·H 2 O, NaCl, KCl, MgCl 6H 2 O. Methanol is chromatographically pure, purchased from Fisher Scientific (Thermo Fisher).
[0045] The experimental water was ultrapure water (resistivity: 18.2 MΩ / cm).
[0046] Nano-100, a micro-volume spectrophotometer, is used to determine the concentration of DNA.
[0047] The preparation of Ver A nucleic acid aptamer assembly liquid: the single-stranded DNA aptamer solution that the 3 ' end of assembly liquid is 769.5 μ g / ml has modified amino group, with 200mM disodium hydrogen phosphate (Na 2 HPO 4 ), 5mM magnesium chloride (MgCl), the aptamer solution of pH 8.0 was dissolved and prepared.
[0048] (2) Construction of aptamer affinity solid-phase extraction column
[0049] (1) Aptamer pretreatment...
Embodiment 3
[0059] Example 3: Enrichment of aptamer-affinity solid-phase extraction column to blank solution spiked sample
[0060] (1) Aptamer affinity column loading, washing and elution
[0061] A) Prepare 100ng / ml Ver A standard solution of BB 6.4 solution containing 6% methanol.
[0062] B) Sample loading: 1ml (equivalent to 0.05g corn, 6% methanol), 100ng / ml of the above mother solution, the speed of passing through the column is 1 drop / 5 seconds, and slowly pass through the aptamer affinity column at an atmospheric pressure. After the 1ml sample has completely passed through the column, use positive pressure to release all the sample liquid in the pipeline.
[0063] C) Washing: add 10ml of BB 6.4 buffer solution, and pass through the column at the same 2 drops / second. After all the BB6.4 buffer has completely passed through the aptamer affinity column, use positive pressure to empty all the liquid in the pipeline, and then vacuumize for 30 seconds to completely empty all the BB6....
PUM
| Property | Measurement | Unit |
|---|---|---|
| electrical resistivity | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More