Building of stable cell line carrying orthogonal tRNA/arginyl tRNA synthetase

A cell line and enzyme synthesis technology, applied in the field of biopharmaceuticals, can solve problems such as the bottleneck of industrial application of gene codon expansion technology, achieve specific modification and achieve stable expression

Active Publication Date: 2017-08-04
PEKING UNIV
View PDF6 Cites 12 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] (3) The bottleneck of industrial application of gene codon expansion technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Building of stable cell line carrying orthogonal tRNA/arginyl tRNA synthetase
  • Building of stable cell line carrying orthogonal tRNA/arginyl tRNA synthetase
  • Building of stable cell line carrying orthogonal tRNA/arginyl tRNA synthetase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: Construction and acquisition of double lentiviral vector

[0062] (1) Obtaining the carrier skeleton

[0063] The backbone of the double lentiviral vector is the lentiviral vector pSD31 (Zhang Jing. et al. RNA, 2007, 13:1375–1383.), in which the sv40 promoter promotes the puromycin resistance gene protein puro R expression.

[0064] (2) Primer design for SOE PCR

[0065] The inventors used SOE PCR to splice the DNA fragments of the internal ribosome entry sequence (IRES) and the puromycin (puromycin) resistance gene / hygromycin B (hygromycin) resistance gene to obtain IRES-puro and IRES- hygro fragment, the specific primers are shown in the table below.

[0066] Table 1: List of SOE PCR primers

[0067] mutation site Sequence (5'-3' direction) IRES-hygro-for (BamHI) CGGGATCCAATTCCGCCCCTCTC IRES-hygro-middle-for: CCCACAAGGAGACGACCTTCCATGAAAAAGCCTGAACTCACC IRES-hygro-middle-rev: GGTGAGTTCAGGCTTTTTCATGGAAGGTCGTCTCCTTGTGGG ...

Embodiment 2

[0070] Example 2: Construction and acquisition of pXH-12tRNA-zeo vector

[0071] In order to ensure the expression of tRNA, it is necessary to clone multiple copies of the promoter-tRNA expressed in tandem into an appropriate vector. In the present invention, the pXH blank vector is used as the backbone, and the zeomycin-polyA sequence is introduced into the back of the SV40 promoter through the EcoRI restriction site, so that it has bleomycin resistance. After that, 12 copies of the promoter-tRNA sequence were cloned into the pXH-zeo vector using the SalI restriction site. In order to avoid the possibility of recombination of repeated sequences, 4 different tRNA promoters were used: 7sk / hu6 / H1 / mu6. Finally, the vector bjmu-12t-zeo for screening tRNA was obtained.

[0072] (1) Obtaining the carrier skeleton

[0073] The backbone of the pXH-12tRNA-zeo vector is the vector pXH, which is a shuttle vector transformed from the PUC19 vector, which has the advantages of being abl...

Embodiment 3

[0083] Example 3: Screening of Stable Cell Lines

[0084] (1) Packaging and transduction of lentivirus, including the following steps:

[0085] a.HEK 293T cell plating: use medium A, components (DMEM+10%FBS,1×NEAA,without sodium pyruvate), cell digestion and counting, the number of cells seeded in each well of a six-well plate is 4×10 5 cells / well.

[0086] b. Lentivirus packaging: Transfection is performed at a cell density of 70% to 80%, and the mixture of plasmids and transfection reagents is shown in Table 3-1. Six hours after transfection, medium B (DMEM+3% FBS, 1×NEAA, With Sodium Pyruvate) was changed. Continue to cultivate. The virus liquid was collected 48 hours and 72 hours after transfection, and filtered with a PVDF membrane syringe filter with a pore size of 0.45 μm.

[0087] Table 3-1. Plasmid ratio for lentiviral packaging

[0088] Plasmids / Transfection Reagents Dosage per well Opti-MEM 200μl transfer vector 0.72μg pRSV 0.64...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a building method of a stable cell line carrying orthogonal tRNA / arginyl tRNA synthetase. On the basis of a gene codon expansion technology, a pair of orthogonal tRNA / arginyl tRNA synthetase is used for introducing unnatural amino acid into a fixed point of protein. The invention also relates to a building method of double lentiviral vectors, a building method of a multi-copy-number tRNA carrying carrier and a method for stably integrating the orthogonal tRNA / arginyl tRNA synthetase gene into the cell genome through double lentiviral stable transduction and plasmid stable transfection. The invention further relates to application of the stable cell line, such as the purpose of expressing the target protein containingunnatural amino acid.

Description

technical field [0001] The invention belongs to the field of biopharmaceuticals and relates to a method for constructing a stable cell line carrying orthogonal tRNA / aminoacyl tRNA synthetase. Background technique [0002] (1) Gene codon extension technology [0003] In recent years, the genetic code expansion technology has developed rapidly. Using the amber stop codon as the sense codon, the designed unnatural amino acid can be introduced into the protein by introducing the corresponding orthogonal tRNA and aminoacyl tRNA synthetase. According to the properties of unnatural amino acids, proteins can be endowed with special functions. So far, this technology has successfully expressed hundreds of unnatural amino acids on the surface of proteins. The unnatural amino acids involved include azide, alkynyl, ketone, aldehyde, alkenyl, amide, nitro , phosphate, sulfonate and other diverse functional groups can perform a variety of bioorthogonal reactions, such as: click chemistr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N5/10C12N15/63C12N9/02C12N15/53
CPCC12N5/0686C12N9/0069C12N9/93C12N15/11C12N15/65C12N15/86C12N2510/00C12N2740/15043C12N2800/107C12N2840/203C12Y113/12007C12Y601/01026
Inventor周德敏夏青徐欢张博司龙龙杨琦姚天卓张礼和
OwnerPEKING UNIV