Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

CRISPR/Cpf1 plant genome directional modification function unit, carrier comprising function unit, and application thereof

A plant genome and functional unit technology, applied in the field of CRISPR/Cpf1 plant genome directed modification functional unit, can solve the problems of low shear editing efficiency, limited CRISPR/Cpf1 research, poor genetic stability, etc.

Active Publication Date: 2017-08-04
UNIV OF ELECTRONIC SCI & TECH OF CHINA
View PDF1 Cites 51 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Recently, two research groups published preliminary reports on plant CRISPR / Cpf1 (1, Endo A, Masafumi M, Kaya H, Toki S. 2016. Efficient targeted mutagenesis of rice and tobacco genomes using Cpf1 from Francisella novicida. Scientific Reports, 6: 38169.doi:10.1038 / srep38169; 2. Xu R, Qin R, Li H, Li D, Li L, Wei P, YangJ. 2016. Generation of targeted mutant rice using a CRISPR-Cpf1 system. Plant Biotechnol Journal, doi: 10.1111 / pbi.12669.), but the results showed that CRISPR / Cpf1 showed lower shear editing efficiency and poor genetic stability in plant cells
This makes whether CRISPR / Cpf1 can be similar to CRISPR / Cas9 as an effective tool for targeted editing of plant genomes has been questioned, which greatly limits the research and application of CRISPR / Cpf1 in targeted modification of plant genomes

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR/Cpf1 plant genome directional modification function unit, carrier comprising function unit, and application thereof
  • CRISPR/Cpf1 plant genome directional modification function unit, carrier comprising function unit, and application thereof
  • CRISPR/Cpf1 plant genome directional modification function unit, carrier comprising function unit, and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0073] Example 1 Construction of CRISPR / Cpf1 Plant Genome Directed Modification Backbone Vector

[0074] The invention relates to a CRISPR / Cpf1 genome directional modification backbone carrier for plant genome engineering, the core of which comprises a Cpf1 nuclease protein expression unit and a guide crRNA transcription expression cloning unit. The Cpf1 nuclease protein expression unit consists of a Pol Ⅱ type promoter, a Cpf1 protein coding frame (including the nuclear localization signal NLS), and a transcription terminator. The crRNA transcription and expression cloning unit is composed of PolⅡ type promoter, HH ribozyme, crRNA cloning unit (BsaI-ccdB-BsaI unit fused at the 3' end), HDV ribozyme, and Nos transcription terminator element in sequence.

[0075]The Cpf1 nuclease protein coding gene (LbCpf1, whose nucleotide sequence is as Seq ID No.5) of Lachnospiraceae bacterium ND2006 is fused to the nuclear localization signal (NLS) at the 5' end and the 3' end respectively...

Embodiment 2

[0077] Example 2 Directed modification of rice endogenous gene OsPDS based on CRISPR / Cpf1 system

[0078] 1. Design of rice OsPDS gene guide crRNA and construction of Cpf1+crRNA recombinant expression vector

[0079] Based on the rice OsPDS sequence (NCBI No. NM001055721) as the reference sequence, based on the 73bp-99bp (Seq IDNo.7: TTTG GAGTGAAATCTCTTGTCTTAAGG, the underline is the PAM site) region, design OsPDS-crRNA01 (Table 1). Table 1 Design, synthesis and detection information of rice OsPDS gene guide crRNA

[0080]

[0081] According to the designed OsPDS-crRNA01 site nucleic acid sequence, artificially synthesize the corresponding forward and reverse oligonucleotide chains, the specific sequence is as follows (uppercase base sequence represents the designed site-specific guide crRNA site; lowercase base sequence represent cohesive ends complementary to the backbone vector):

[0082] OsPDS-crRNA01-F:agatGAGTGAAATCTCTTGTCTTAAGG (Seq ID No.11);

[0083] OsPDS-crR...

Embodiment 3

[0093] Example 3 Directed Modification of Rice Endogenous Gene OsDEP1 Based on CRISPR / Cpf1 System

[0094] 1. Design of rice OsDEP1 gene guide crRNA and construction of Cpf1+crRNA recombinant expression vector

[0095] Based on the rice OSDEP1 sequence (NCBI No. FJ039904) as the reference sequence, according to the 3241BP-3267BP (SeqID No.14: TTTG CTACTGTTGCAAGTGCTCACCCCA, the underline is the PAM site) region and 2745BP-2771BP (Seq ID No.15: TTTC CAGAAAGAGAAGGAGGCACAGAT, the underline is the PAM site) region, and OSDEP1-crRNA01 and OSDEP1-crRNA02 were designed respectively (Table 3).

[0096] Table 3 Design, synthesis and detection information of rice OsDEP1 gene guide crRNA

[0097]

[0098] According to the designed nucleic acid sequences of OsDEP1-crRNA01 and OsDEP1-crRNA02 sites, artificially synthesize the corresponding forward and reverse oligonucleotide chains, and the specific sequences are as follows (the uppercase base sequence represents the designed site-sp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and concretely relates to a CRISPR / Cpf1 plant genome directional modification function unit, a carrier comprising the function unit, and application thereof. The invention aims to build an effective plant genome CRISPR / Cpf1 directional modification framework carrier according to an action principle of a CRISPR / Cpf1 system and a vegetable cell gene expression characteristic, and realize high-efficient application thereof in plant genome directional modification. The technical scheme provided by the invention is characterized by building the CRISPR / Cpf1 plant genome directional modification framework carrier formed by lachnospiraceae bacterium Cpf1 nuclease protein (LbCpf1) expression unit and a guiding crRNA transcription expression unit. The invention also provides a method for designing specificity-guided crRNA and building a CRISPR / Cpf1 recombinant expression vector aiming at rice genome target loci by adopting the CRISPR / Cpf1 plant genome directional modification framework carrier. The invention provides the high-efficient CRISPR / Cpf1 plant directional modification framework carrier, which can effectively realize simple, fast and high-efficient directional modification based on the CRISPR / Cpf1 system aiming at a plant genome target sequence.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a CRISPR / Cpf1 plant genome directional modification functional unit, a carrier containing the framework and an application method thereof. Background technique [0002] Targeted genome modification has always been a frontier and hot spot in biological research. Through precise targeted modification of specific regions of the genome: on the one hand, it can precisely mutate the target sequence, obtain mutation materials, and clearly identify the function of the target gene; on the other hand, it can Precise replacement or insertion of the target sequence minimizes the uncertainty of expression and inheritance caused by the random introduction of foreign genes. Since 1996, researchers have successively reported the DNA-directed shearing activity of ZFN (Kim et al., 1996), TALEN (Christian et al., 2010), and CRISPR / Cas9 (Jinek et al., 2012), which have been widely Applied to the dir...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82
CPCC12N15/8213
Inventor 张勇唐旭郑雪莲邓科君周建平
Owner UNIV OF ELECTRONIC SCI & TECH OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com