Method for screening MKL-1 protein interaction proteins via yeast two-hybrid screening
A yeast two-hybrid and protein technology, applied in the field of genetic biology, can solve problems such as complicated operation, many false positives and false negatives, and difficulty in accurately judging the strength of protein interaction
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Example 1: Optimization scheme for library amplification in yeast two-hybrid (taking the cDNA library of human fetal brain as an example)
[0028]1. Aspirate 1 μL of bacterial liquid from the originally purchased library stored in the form of Escherichia coli, and perform a series of serial dilutions. In this example, the human fetal brain cDNA library was diluted at 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Dilution is carried out, and the titer of the bacterial solution is accurately calculated according to the number of colonies on the plates coated with serial dilutions. Generally, 2 gradient dilutions are used for calculation. Since errors are likely to occur during the experiment, the calculation results are inconsistent. Therefore, 6 gradient dilutions are used in this experiment to reduce the error. The titer of the library in this example is 2×10 8 .
[0029] 2. Generally, the average number of colonies coated with 150 μL bacteria on an LB plate with ...
Embodiment 2
[0034] Example 2: Preparation of recombinant yeast for bait protein
[0035] In order to construct the MKL-1 gene cDNA clone on the yeast two-hybrid bait vector, it is necessary to amplify the vector containing the target gene and digest it with SfiI to obtain the clone fragment, and combine it with the yeast two-hybrid bait vector plasmid digested with SfiI pGBKT7 vector ligation.
[0036] 1. Primer Synthesis
[0037] According to the cDNA sequence of the MKL-1 gene, primers were designed to amplify the cDNA fragment of the MKL-1 gene by adding SfiI restriction site sequences at both ends. The primer sequences are as follows:
[0038] MKL-1-F: aaGGCCATTAC GGCCATGGCAAGTAACTGTGAGAAAATG
[0039] MKL-1-R: ccGGCC GAGGC GGCC TTAGAGGTTCCCATTTTGTTTG
[0040] 2. Target gene amplification
[0041] Thermal polymerase used to amplify target fragments: full-form gold TransStartFastPfu DNA Polymerase
[0042]
[0043] Such as figure 1 As shown, band M is DNA Marker, and the concen...
Embodiment 3
[0062] Example 3: cDNA library transformation and screening of quasi-positive clones
[0063] Use the AH109 yeast transformant containing the correct pGBKT7-MKL-1 bait plasmid as the recipient strain to prepare competent cells, transfer the library plasmid pGADT7--cDNA into it, and spread SD-Trp-Leu-His+5mM 3AT plate.
[0064] 1) Pick a monoclonal strain from the SD-T plate and inoculate it in 50ml of liquid SD-T medium, shake at 30°C, 225rpm for 18h;
[0065] 2) Transfer to 500ml of YPDA liquid to make the initial OD 600 =0.2, 30°C, 225rpm, shaking culture for 4-5h, until OD 600 =0.6;
[0066] 3) Collect bacteria by centrifugation, room temperature, 4000rpm, 5min;
[0067] 4) Resuspend the bacteria with 30ml of sterile water, mix well, collect the bacteria by centrifugation, room temperature, 4000rpm, 5min, discard the supernatant;
[0068] 5) Resuspend the bacteria with 20ml 0.1M LiAc, mix well, collect the bacteria by centrifugation, room temperature, 4000rpm, 5min, dis...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



