Method for screening MKL-1 protein interaction proteins via yeast two-hybrid screening

A yeast two-hybrid and protein technology, applied in the field of genetic biology, can solve problems such as complicated operation, many false positives and false negatives, and difficulty in accurately judging the strength of protein interaction

Inactive Publication Date: 2017-08-11
WUHAN UNIV OF SCI & TECH
View PDF3 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] The current yeast two-hybrid method has complex operations, many false positives and false negatives, the results are mainly qualitative data, and it is difficult to accurately determine the strength of protein interactions.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for screening MKL-1 protein interaction proteins via yeast two-hybrid screening
  • Method for screening MKL-1 protein interaction proteins via yeast two-hybrid screening
  • Method for screening MKL-1 protein interaction proteins via yeast two-hybrid screening

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1: Optimization scheme for library amplification in yeast two-hybrid (taking the cDNA library of human fetal brain as an example)

[0028]1. Aspirate 1 μL of bacterial liquid from the originally purchased library stored in the form of Escherichia coli, and perform a series of serial dilutions. In this example, the human fetal brain cDNA library was diluted at 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Dilution is carried out, and the titer of the bacterial solution is accurately calculated according to the number of colonies on the plates coated with serial dilutions. Generally, 2 gradient dilutions are used for calculation. Since errors are likely to occur during the experiment, the calculation results are inconsistent. Therefore, 6 gradient dilutions are used in this experiment to reduce the error. The titer of the library in this example is 2×10 8 .

[0029] 2. Generally, the average number of colonies coated with 150 μL bacteria on an LB plate with ...

Embodiment 2

[0034] Example 2: Preparation of recombinant yeast for bait protein

[0035] In order to construct the MKL-1 gene cDNA clone on the yeast two-hybrid bait vector, it is necessary to amplify the vector containing the target gene and digest it with SfiI to obtain the clone fragment, and combine it with the yeast two-hybrid bait vector plasmid digested with SfiI pGBKT7 vector ligation.

[0036] 1. Primer Synthesis

[0037] According to the cDNA sequence of the MKL-1 gene, primers were designed to amplify the cDNA fragment of the MKL-1 gene by adding SfiI restriction site sequences at both ends. The primer sequences are as follows:

[0038] MKL-1-F: aaGGCCATTAC GGCCATGGCAAGTAACTGTGAGAAAATG

[0039] MKL-1-R: ccGGCC GAGGC GGCC TTAGAGGTTCCCATTTTGTTTG

[0040] 2. Target gene amplification

[0041] Thermal polymerase used to amplify target fragments: full-form gold TransStartFastPfu DNA Polymerase

[0042]

[0043] Such as figure 1 As shown, band M is DNA Marker, and the concen...

Embodiment 3

[0062] Example 3: cDNA library transformation and screening of quasi-positive clones

[0063] Use the AH109 yeast transformant containing the correct pGBKT7-MKL-1 bait plasmid as the recipient strain to prepare competent cells, transfer the library plasmid pGADT7--cDNA into it, and spread SD-Trp-Leu-His+5mM 3AT plate.

[0064] 1) Pick a monoclonal strain from the SD-T plate and inoculate it in 50ml of liquid SD-T medium, shake at 30°C, 225rpm for 18h;

[0065] 2) Transfer to 500ml of YPDA liquid to make the initial OD 600 =0.2, 30°C, 225rpm, shaking culture for 4-5h, until OD 600 =0.6;

[0066] 3) Collect bacteria by centrifugation, room temperature, 4000rpm, 5min;

[0067] 4) Resuspend the bacteria with 30ml of sterile water, mix well, collect the bacteria by centrifugation, room temperature, 4000rpm, 5min, discard the supernatant;

[0068] 5) Resuspend the bacteria with 20ml 0.1M LiAc, mix well, collect the bacteria by centrifugation, room temperature, 4000rpm, 5min, dis...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of genetic biology, in particular to a method screening MKL-1 protein interaction proteins via yeast two-hybrid screening. A recombinant yeast capable of expressing bait protein MKL-1 is prepared, cDNA library is transformed to the recombinant yeast, the two nutrient defects, His and Ade, and chromogenic reaction are used alone or in combination, and positive clones having different interactive intensities to the protein MKL-1 are acquired by further screening. By means of gradually increasing the selective pressure, it is convenient to quickly screen out proteins having different interactive degrees to the protein MKL-1, subsequent validation experiments are facilitated, and the method is significant to further elaboration of the functionality and regulatory effect of MKl-1 in the genesis and development of leukemia.

Description

technical field [0001] The invention relates to the technical field of genetic biology, in particular to a method for yeast two-hybrid screening of proteins interacting with MKL-1 protein. Background technique [0002] The genome project has continuously discovered a large number of new genes, but the simple genome DNA sequence cannot solve many life problems. Genes are relatively static, while the products encoded by genes—proteins—are dynamic. The expression level, existence mode, and interaction of proteins are directly related to the functions of organisms. The interaction between life activities and proteins is also inseparable, such as DNA synthesis, gene transcription activation, protein translation, cell cycle regulation, signal transduction and other important life processes all involve the role of protein complexes. The nature of the various interactions of proteins is very different. Some connections are strong, such as structural, while others are weak and time-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/81C12N15/65
CPCC12N15/65C12N15/81C12Q1/6897C12Q2565/201
Inventor廖兴华李佳蓬项园张同存
OwnerWUHAN UNIV OF SCI & TECH