A kind of ige-specific nucleic acid aptamer, its application and aptamer medicine
A nucleic acid aptamer and aptamer technology, which can be used in drug combinations, pharmaceutical formulations, allergic diseases, etc., can solve the problems of poor aptamer specificity and high production costs, and achieve high specificity, cost savings, and shortened core Effect of nucleotide length
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1 The acquisition of IgE-specific nucleic acid aptamers
[0025] In the present invention, the 80bp A1 aptamer is used as the lead molecule, and optimization is carried out on the basis thereof to obtain the target aptamer whose nucleotide sequence is shown in SEQ ID NO:1.
[0026] First, in the present invention, the nucleotide sequence of the A1 adapter as the lead molecule is:
[0027] 5'- ACCGACCGTGCTGGACTCTG - CCCCGCTGCCTTGCATCTGTCTTGTCTTTAATGGTATCCA- CAGTATGAGCGAGCGTTGCG -3', where the underlined part is a fixed sequence, and its secondary structure is predicted by Mfold software, see Figure 12 .
[0028] The process of obtaining a nucleotide sequence such as the target aptamer of SEQ ID NO: 1 is:
[0029] 1. According to the secondary structure of the A1 aptamer, selectively delete part of the sequence in the A1 aptamer, the nucleic acid sequence to be retained is synthesized by Shanghai Sangon Biotechnology Co., Ltd., and the newly synthesized re...
Embodiment 2
[0048] Example 2 Verification test at cell level
[0049] DMEM and FBS were mixed at 9:1 (v:v), cultured RBL-2H3 cells, 37°C, 5%CO 2 Cultivate in an incubator, change the medium and digest according to the growth of the cells, and collect the logarithmic phase cells after the growth is stable. Cells in the logarithmic growth phase were taken, and the concentration was adjusted to 2×10 5 cells / mL, inoculated in a 24-well plate at 1 mL / well, and placed in an incubator at 37 °C, 5% CO 2 After culturing under the conditions for 12 hours, discard the culture medium, wash with PBS for 3 times, add 1 mL of PBS to each well, put it in the incubator for 10 minutes, and then add the medicine, add DMEM, FBS, DNP-IgE and DNP-IgE at a final concentration of 0.1 μg / mL to each well A total of 1 mL of G39-A1-29C aptamer with different final concentrations (1, 10, 100 μmol / L) was used as a therapeutic agent, and a positive control group without a therapeutic agent was set at the same time,...
Embodiment 3
[0055] Example 3 Animal Level Verification Test
[0056] 1. Passive cutaneous anaphylaxis (PCA) experiment on the back of rats:
[0057] 20 rats, male and female, were randomly divided into two groups. They were anesthetized with ether. The first group was the DNP-IgE dose optimization experimental group. The sensitizer DNP-IgE 50ng, 100ng, and 200ng were injected intradermally on both sides of the back along the midline. They were recorded as low, medium and high dose points, injected with normal saline as a blank control point, and 4 hours later, injected a mixture of 1 mg / mL DNP-BSA 100 μL and 1% Evans blue 300 μL into the tail vein, and 30 minutes later, they were anesthetized and sacrificed, and the skin on the back was cut off , measure the diameter of the coeruleus coeruleus inside the skin, cut the coeruleus coeruleus along the outline of the coeruleus, cut it into pieces, and put it in 1mL Na 2 SO 4 Soak in a mixture of acetone (3:7) at 37°C for 24 hours, centrifuge...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More