Inducible CRISPRon or CRISPRi mouse embryo stem cells and application thereof
A mouse embryo and stem cell technology, applied in embryonic cells, cells modified by introducing foreign genetic material, applications, etc., can solve problems such as genome changes, and achieve stable expression, high homologous recombination efficiency, and high efficiency.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Preparation of inducible CRISPRon and CRISPRi mouse embryonic stem cells
[0041] PCR was performed using dCas9-VPR and dCas9-KRAB expression vectors (Addgene #63800 and #50917) as templates, respectively. See Table 1 for PCR primers.
[0042] Table 1 PCR primers
[0043] Primer name Sequence (5'-3') SEQ ID NO. dCas9-VPR upstream primer ATGGACAAGAAGTACTCCATTGG 1 dCas9-VPR downstream primer TTAAAACAAACTTGTGTCAAATA 2 dCas9-KRAB upstream primer ATGGACAAGAAGTACTCCATTGG 3 dCas9-KRAB downstream primer TTATACCAGCCAAGGTTCTTCCC 4
[0044] PCR reaction system:
[0045]
[0046]
[0047] Add 10μl easy Taq enzyme and extend at 72°C for 20min.
[0048] The above two PCR fragments were respectively constructed on the pCR8-Entry vector (Invitrogen), and then by LR reaction (Invitrogen TM Gateway TM cloning system) into the p2Lox-FLAG vector containing LoxP sites (Mazzoni, E.O. et al., 2010), and the resulting cons...
Embodiment 2
[0059] Example 2 Inducibility and reversibility of dCas9-VPR or dCas9-KRAB fusion protein expression
[0060] The mouse embryonic stem cell clone TRE-dCas9-VPR or TRE-dCas9-KRAB obtained in Example 1 was placed in a mouse embryonic stem cell culture medium (GMEM medium, 15% fetal bovine serum, 0.1mM β-mercaptoethanol, 2mM glutamine , 0.1mM non-essential amino acids, 1% penicillin / streptomycin, 1mM sodium pyruvate, 5ng / ml LIF (leukemia inhibitory factor), the culture dish used for mouse embryonic stem cells should be pre-coated with 0.1% gelatin) , add doxycycline at a final concentration of 500ng / ml, remove doxycycline after 24 hours of culture, replace with mouse embryonic stem cell medium without doxycycline, and then culture for 24, 48, and 72 hours respectively; Kinetin was used as an internal reference. The expression levels of dCas9-KRAB and dCas9-VPR fusion proteins were detected by western blot, and the results were as follows image 3 As shown, dCas9-KRAB and dCas9-...
Embodiment 3
[0062] Example 3 Regulation of target gene expression by sgRNA targeting genes
[0063] (1) Design the sgRNA targeting Nkx2.5 according to the sequence near the transcription start site, and its sequence is SEQ ID NO.5: CGGGCGGCGGGCACCATGCG. The design method of sgRNA is a routine technique in the art, and those skilled in the art can also choose sgRNA design software or online design (such as http: / / www.e-crisp.org / E-CRISP / , http: / / crispr.mit.edu / etc.) to design the corresponding sgRNA, which will not be repeated here. The sgRNA was cloned into the pLX-sgRNA vector (addgene #50662), packaged with lentivirus, infected the TRE-dCas9-VPR and TRE-dCas9-KRAB cells prepared in Example 1, and added Blasticidin (4 μg / ml) for screening two days later. Add doxycycline at a final concentration of 500ng / ml to the surviving cells after 4-6 days of screening, and after incubation for 48 hours, detect the mRNA expression level of the corresponding target gene relative to Nkx2.5 in ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com