Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of CvBv5-3 gene to reduction of immunity of fruit fly and preparation of fruit fly model with low immunity

A technology of low immunity and immunity, applied in the field of molecular biology and genetic engineering, can solve the problem of death of transgenic fruit flies and achieve the effect of enhanced screening

Active Publication Date: 2017-10-24
ZHEJIANG UNIV
View PDF2 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, more toxic genes are usually easy to cause the death of transgenic fruit flies; therefore, finding suitable toxic genes is an important part of establishing immune-compromised fruit flies

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of CvBv5-3 gene to reduction of immunity of fruit fly and preparation of fruit fly model with low immunity
  • Application of CvBv5-3 gene to reduction of immunity of fruit fly and preparation of fruit fly model with low immunity
  • Application of CvBv5-3 gene to reduction of immunity of fruit fly and preparation of fruit fly model with low immunity

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] 1. Construction of transgenic Drosophila

[0030] According to the sequences at both ends of the open reading frame (ORF, shown in SEQ ID NO.1) of the CvBV5-3 gene and the sequence of the multiple cloning site on the pUASttb vector, combined with the mode of action of homologous recombinase, specific primers were designed. The primer sequences are as follows:

[0031] F: 5'- TTCGTTAACAGATCTGCGGCCGC ATGGTGTTCAAACAAAACCTTAAT-3'

[0032] R: 5'- TCCTCTAGAGGTACCTCTCGAG TTAATCTTTGATAATAATTGGTCC-3';

[0033] Trizol (Invitrogen, Carlsbad, CA, USA) was used to extract total RNA from hemocytes of Plutella xylostella after parasitism, and a cDNA library was constructed using the kit SMART RACE cDNA Amplification kit (Clontech, USA). Then, use specific primers F and R to PCR amplify the CvBV5-3 gene fragment with restriction sites from the cDNA library constructed, and use homologous recombinase (ClonExpress II One Step Cloning Kit, Novozyme, Nanjing ) to recombine the fragme...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses application of CvBv5-3 gene to reduction of immunity of fruit fly and preparation of fruit fly model with low immunity. The CvBv5-3 gene is the third gene of the fifth ring of the 35th genome segment in polydnavirus of a cotesia vestalis, and a base sequence of the CvBv5-3 gene is shown as SEQ ID NO. 1. According to the application, the CvBv5-3 gene in polydnavirus of the cotesia vestalis is transferred into fruit fly strains, and transgenic fruit fly strains with stable inheritance and homozygote are obtained. After the transgenic fruit fly strains express the polydnavirus gene CvBv5-3, the phenomenon of blood cell apoptosis exists. In addition, when being infected by pathogen, the transgenic fruit fly strains has an obvious character of low immunity, and has important meaning in the aspects of research of relevant mechanism of insect immunity and enhancement of human immunological medicaments screening and the like.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and genetic engineering, in particular to the application of CvBV5-3 gene in reducing the immunity of Drosophila and preparing an immunocompromised Drosophila model. Background technique [0002] Insects are currently the most prosperous species group on the earth's land, and they are an inexhaustible treasure house of resources for human beings. In recent years, the immunity of insects has received great attention in its basic and applied research. Experiments are used to study the mechanisms and signals related to insect immunity. etc. have very important practical significance. [0003] Fruit flies belong to the order Diptera, the genus Drosophila, and the family Drosophila, with about 1,000 species. Among them, Drosophila has the characteristics of short life cycle, easy breeding, fast reproduction, few chromosomes, many mutant types, and easy observation. It is widely used as an ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/34C07K14/01C12N15/85A01K67/033
Inventor 陈学新王泽华时敏黄健华胡荣敏
Owner ZHEJIANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products