Embedded antigen receptor based on CD30 and application thereof

A technology of chimeric antigen receptors and antigens, which is applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, and easy escape from immune mechanisms, and achieve the effect of enhanced immune effect and high expression

A technology of chimeric antigen receptors and antigens, which is applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, and easy escape from immune mechanisms, and achieve the effect of enhanced immune effect and high expression

CN107312097AActive Publication Date: 2017-11-03SHENZHEN GENO IMMUNE MEDICAL INST

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Embedded antigen receptor based on CD30 and application thereof
  • Embedded antigen receptor based on CD30 and application thereof
  • Embedded antigen receptor based on CD30 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1: Construction of Chimeric Antigen Receptor

[0056] (1) Synthesize Secretory signal peptide, CD30 antigen binding domain, CD8α and / or CD28 transmembrane domain, CD28 signaling domain, CD27 signaling domain and CD137 signaling domain, CD3ζ signaling domain through whole gene synthesis , 2A sequence and caspase 9 domain, such as figure 1 Shown, namely Secretory-CD30-CD28-CD27-CD137-CD3ζ-2A-FBKP.Casp9;

[0057] The nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:

[0058] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCCAGATCCAGCTGGTGCAGAGCGGCGCCGAGGTGAAGAAGCCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCTTCACCGACTACTACATCACCTGGGTGAGACAGGCCCCCGGCCAGGGCCTGGAGTGGATGGGCTGGATCTACCCCGGCAGCGGCAACACCAAGTACAACGAGAAGTTCAAGGGCAGAGTGACCATGACCAGAGACACCAGCATCAGCACCGCCTACATGGAGCTGAGCAGACTGAGAAGCGACGACACCGCCGTGTACTACTGCGCCAACTACGGCAACTACTGGTTCGCCTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAG...

Embodiment 2

[0059] Example 2: Lentiviral packaging

[0060] (1) Culture 293T cells in a six-well plate, 1×10 6 cells / well, cultivated for 17-18 hours;

[0061] (2) Add 600 μL / well of fresh DMEM containing 10% FBS;

[0062] (3) Add the following reagents to a sterile centrifuge tube: Take 75 μL of DMEM supernatant per well, 2.7 μg of helperDNA mix (1.8 μg pNHP, 0.5 μg pHEF-VSV-G, 0.2 μg pHEF-GFP) and 0.8 μg of pTYF DNA vector, vortex;

[0063] (4) Pipette 7 μL of Superfect from the center of each well plate into the centrifuge tube for 5 times, and let stand at room temperature for 7-10 minutes;

[0064] (5) Add the DNA-Superfect mixture in the centrifuge tube to each culture well drop by drop, and vortex to mix well;

[0065] (6) 37°C 3% CO 2 Cultivate in the incubator for 4-5 hours;

[0066] (7) Aspirate the culture medium of the medium, wash the medium with 1.5mL AIM-V, and add 1.5mL of AIM-V to continue culturing;

[0067] (8) Return the culture medium to 3% CO 2 Culture overnigh...

Embodiment 3

[0068] Example 3: Purification and concentration of lentivirus

[0069] 1) Virus purification

[0070] Cell debris was removed by centrifugation (1000g, 5 minutes) to obtain virus supernatant, which was filtered through a 0.45 micron low protein binding filter, virus was aliquoted and stored at -80°C;

[0071] Typically, transfected cells can produce 10 6 to 10 7 Lentiviral vectors for titration of transducing units.

[0072] 2) Concentrate lentiviral vectors with Centricon filters

[0073] (1) In a biological safety cabinet, take a Centricon tube, disinfect it once with 70% alcohol, and then wash it three times with sterile PBS;

[0074] (2) Add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5ml;

[0075] (3) Shake the filter tube, then centrifuge at 400g for 2 minutes to collect the concentrated virus into the collection cup. Finally, pool the virus in all tubes into one ce...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an embedded antigen receptor based on CD30 and application thereof, and particularly relates to a building method of an embedded antigen receptor T (CAR-T) cell technology based on a tumor specific target site CD30 and application thereof in anti-tumor treatment. The embedded antigen receptor is prepared by connecting an antigen binding structural domain, a transmembrane structural domain, a costimulatory signal conducting region and a CD3 zeta signal conducting structural domain in series, wherein the antigen binding structural domain is combined with tumor-surface antigen, and the tumor-surface antigen is CD30. By adopting the embedded antigen receptor, specific gene transformation on a single chain antibody of the tumor-surface antigen CD30 is carried out, and because of the transformed antibody, the binding force of the antigen-antibody is stronger, and the mutation difficultly occurs; compared with other embedded antigen receptors and other tumor antigens, the embedded antigen receptor has a better effect, and the expression quantity of the target site is high, so that an immunization effect of CAR-T cells is enhanced, and a treatment effect on the CAR-T cells is enhanced.

Description

technical field [0001] The present invention relates to the field of tumor cell immunotherapy, in particular to a CD30-based chimeric antigen receptor and its application, specifically the chimeric antigen receptor T (CAR-T) cell technology based on tumor-specific target CD30 The construction method and its application in anti-tumor therapy. Background technique [0002] With the development of tumor immunology theory and clinical technology, chimeric antigen receptor T-cell immunotherapy (CAR-T) has become one of the most promising tumor immunotherapy. Generally, a chimeric antigen receptor CAR consists of a tumor-associated antigen-binding region, an extracellular hinge region, a transmembrane region, and an intracellular signal transduction region. Usually, CAR contains the single chain fragment variable (single chain fragment variable, scFv) region of the antibody or the binding domain specific to the tumor associated antigen (tumor associated antigen, TAA), which commu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
03 Nov 2017
Publication
CN107312097A
IPC
C07K19/00; C12N7/01; C12N5/10; A61K35/17; A61P35/00; A61P35/02
CPC
A61K35/17; C07K14/7051; C07K14/70517; C07K14/70521; C07K14/70578; C07K16/2896; C07K2317/622; C07K2319/00
Inventors
李俊芳; 章睿