Embedded antigen receptor based on CD30 and application thereof
A technology of chimeric antigen receptors and antigens, which is applied in the field of tumor cell immunotherapy, can solve the problems of reduced expression, poor curative effect, and easy escape from immune mechanisms, and achieve the effect of enhanced immune effect and high expression
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055] Example 1: Construction of Chimeric Antigen Receptor
[0056] (1) Synthesize Secretory signal peptide, CD30 antigen binding domain, CD8α and / or CD28 transmembrane domain, CD28 signaling domain, CD27 signaling domain and CD137 signaling domain, CD3ζ signaling domain through whole gene synthesis , 2A sequence and caspase 9 domain, such as figure 1 Shown, namely Secretory-CD30-CD28-CD27-CD137-CD3ζ-2A-FBKP.Casp9;
[0057] The nucleotide sequence SEQ ID NO.3 of the chimeric antigen receptor is as follows:
[0058] ATGCTGCTGCTGGTGACCAGCCTGCTGCTGTGCGAGCTGCCCCACCCCGCCTTCCTGCTGATCCCCCAGATCCAGCTGGTGCAGAGCGGCGCCGAGGTGAAGAAGCCCGGCGCCAGCGTGAAGGTGAGCTGCAAGGCCAGCGGCTACACCTTCACCGACTACTACATCACCTGGGTGAGACAGGCCCCCGGCCAGGGCCTGGAGTGGATGGGCTGGATCTACCCCGGCAGCGGCAACACCAAGTACAACGAGAAGTTCAAGGGCAGAGTGACCATGACCAGAGACACCAGCATCAGCACCGCCTACATGGAGCTGAGCAGACTGAGAAGCGACGACACCGCCGTGTACTACTGCGCCAACTACGGCAACTACTGGTTCGCCTACTGGGGCCAGGGCACCCTGGTGACCGTGAGCAGCGGCAGCACCAGCGGCAGCGGCAAGCCCGGCAGCAGCGAGGGCAGCACCAAG...
Embodiment 2
[0059] Example 2: Lentiviral packaging
[0060] (1) Culture 293T cells in a six-well plate, 1×10 6 cells / well, cultivated for 17-18 hours;
[0061] (2) Add 600 μL / well of fresh DMEM containing 10% FBS;
[0062] (3) Add the following reagents to a sterile centrifuge tube: Take 75 μL of DMEM supernatant per well, 2.7 μg of helperDNA mix (1.8 μg pNHP, 0.5 μg pHEF-VSV-G, 0.2 μg pHEF-GFP) and 0.8 μg of pTYF DNA vector, vortex;
[0063] (4) Pipette 7 μL of Superfect from the center of each well plate into the centrifuge tube for 5 times, and let stand at room temperature for 7-10 minutes;
[0064] (5) Add the DNA-Superfect mixture in the centrifuge tube to each culture well drop by drop, and vortex to mix well;
[0065] (6) 37°C 3% CO 2 Cultivate in the incubator for 4-5 hours;
[0066] (7) Aspirate the culture medium of the medium, wash the medium with 1.5mL AIM-V, and add 1.5mL of AIM-V to continue culturing;
[0067] (8) Return the culture medium to 3% CO 2 Culture overnigh...
Embodiment 3
[0068] Example 3: Purification and concentration of lentivirus
[0069] 1) Virus purification
[0070] Cell debris was removed by centrifugation (1000g, 5 minutes) to obtain virus supernatant, which was filtered through a 0.45 micron low protein binding filter, virus was aliquoted and stored at -80°C;
[0071] Typically, transfected cells can produce 10 6 to 10 7 Lentiviral vectors for titration of transducing units.
[0072] 2) Concentrate lentiviral vectors with Centricon filters
[0073] (1) In a biological safety cabinet, take a Centricon tube, disinfect it once with 70% alcohol, and then wash it three times with sterile PBS;
[0074] (2) Add 18ml of virus supernatant to each Centricon P-20 filter tube, then centrifuge at 2500g for 30 minutes or until the virus volume is reduced to 0.5ml;
[0075] (3) Shake the filter tube, then centrifuge at 400g for 2 minutes to collect the concentrated virus into the collection cup. Finally, pool the virus in all tubes into one ce...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap