Specific primer for detecting Salmonella pullorum, and kit containing same and application thereof
A detection kit, Salmonella technology, applied in the field of biotechnology detection, to achieve the effects of high sensitivity, prevention of false elimination, and accurate results
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0052] Example 1: Primer Design
[0053] A comprehensive bioinformatics analysis was performed on the whole genome of pullorum, typhoid and Salmonella enteritidis serotypes in GenBank, and finally the SEEP17695 gene (shown in SEQ ID NO.1) was determined as the detection target gene of pullorum pullorum.
[0054] According to the SEEP17695 gene, specific primers were designed using Oligo 6 software, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequences are as follows:
[0055] SEEP17695-idF10: 5'TCTAGCACTGAACTTGGCGA 3' (shown in SEQ ID NO.2);
[0056] SEEP17695-idR10: 5'TGTGTCGCCATTGTAGGTCA 3' (shown in SEQ ID NO.3).
Embodiment 2
[0057] Embodiment 2: the establishment of PCR detection method for Salmonella pullorum
[0058] 1. Experimental strains and reagents
[0059] The experimental strains are shown in Table 1, among which 13 isolates were isolated and identified by the Animal Bacteriosis Laboratory of Harbin Veterinary Research Institute.
[0060] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.
[0061] Table 1 Experimental strains
[0062]
[0063]
[0064] Note: ①: China Veterinary Microbiology Collection Management Center; ②: China Medical Bacteria Collection Management Center; ③: China Industrial Microbiology Culture Collection Management Center; ④: American Type Culture Collection; ⑤: Tiangen Biochemical Technology (Beijing) ) Co., Ltd.; ⑥: preserved in this room.
[0065] 2. Method
[0066] 2.1 Selection of the most suitable enrichment solution and template preparation method
[0067] Five different enrichment solutions were used to amplify Salmo...
Embodiment 3
[0097] Embodiment 3: detection of artificial contamination samples
[0098] In the actual detection process, both chicken manure and chicken may be the objects to be detected. The present invention selects these two samples, artificially pollutes them with Salmonella pullorum, and detects the obtained artificially simulated contaminated samples.
[0099] 1. Detection of artificially contaminated chicken feces samples
[0100] Aseptically collect the feces of SPF chickens under the SPF level feeding environment, take 10g of feces and add them to 90mL SC enrichment solution, and cultivate them overnight. Dilute the overnight culture of Salmonella pullorum pullorum with sterile water 10 times, inoculate the appropriate dilution of the bacterial solution into the chicken manure mixture (10g feces + 90mL SC enrichment solution), and use the method of colony counting to obtain the chicken population. The concentration of Salmonella pullorum, and then calculate the inoculation amoun...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap