Specific primer for detecting Salmonella pullorum, and kit containing same and application thereof

A detection kit, Salmonella technology, applied in the field of biotechnology detection, to achieve the effects of high sensitivity, prevention of false elimination, and accurate results

Active Publication Date: 2017-11-24
HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] Aiming at the problems that Salmonella pullorum is prone to occur in the detection process, the purpose of the present invention is to provide a kind of primer and detection method for quickly and specifically detecting Salmonella pullorum, which can not only distinguish the serum of other common pathogenic Salmonella type and common non-Salmonella pathogens, and can well distinguish Escherichia coli

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Specific primer for detecting Salmonella pullorum, and kit containing same and application thereof
  • Specific primer for detecting Salmonella pullorum, and kit containing same and application thereof
  • Specific primer for detecting Salmonella pullorum, and kit containing same and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Example 1: Primer Design

[0053] A comprehensive bioinformatics analysis was performed on the whole genome of pullorum, typhoid and Salmonella enteritidis serotypes in GenBank, and finally the SEEP17695 gene (shown in SEQ ID NO.1) was determined as the detection target gene of pullorum pullorum.

[0054] According to the SEEP17695 gene, specific primers were designed using Oligo 6 software, and the primers were synthesized by Suzhou Jinweizhi Company. The primer sequences are as follows:

[0055] SEEP17695-idF10: 5'TCTAGCACTGAACTTGGCGA 3' (shown in SEQ ID NO.2);

[0056] SEEP17695-idR10: 5'TGTGTCGCCATTGTAGGTCA 3' (shown in SEQ ID NO.3).

Embodiment 2

[0057] Embodiment 2: the establishment of PCR detection method for Salmonella pullorum

[0058] 1. Experimental strains and reagents

[0059] The experimental strains are shown in Table 1, among which 13 isolates were isolated and identified by the Animal Bacteriosis Laboratory of Harbin Veterinary Research Institute.

[0060] Premix Ex Taq DNA polymerase and Marker DL2000 were purchased from TaKaRa Company.

[0061] Table 1 Experimental strains

[0062]

[0063]

[0064] Note: ①: China Veterinary Microbiology Collection Management Center; ②: China Medical Bacteria Collection Management Center; ③: China Industrial Microbiology Culture Collection Management Center; ④: American Type Culture Collection; ⑤: Tiangen Biochemical Technology (Beijing) ) Co., Ltd.; ⑥: preserved in this room.

[0065] 2. Method

[0066] 2.1 Selection of the most suitable enrichment solution and template preparation method

[0067] Five different enrichment solutions were used to amplify Salmo...

Embodiment 3

[0097] Embodiment 3: detection of artificial contamination samples

[0098] In the actual detection process, both chicken manure and chicken may be the objects to be detected. The present invention selects these two samples, artificially pollutes them with Salmonella pullorum, and detects the obtained artificially simulated contaminated samples.

[0099] 1. Detection of artificially contaminated chicken feces samples

[0100] Aseptically collect the feces of SPF chickens under the SPF level feeding environment, take 10g of feces and add them to 90mL SC enrichment solution, and cultivate them overnight. Dilute the overnight culture of Salmonella pullorum pullorum with sterile water 10 times, inoculate the appropriate dilution of the bacterial solution into the chicken manure mixture (10g feces + 90mL SC enrichment solution), and use the method of colony counting to obtain the chicken population. The concentration of Salmonella pullorum, and then calculate the inoculation amoun...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a specific primer for detecting Salmonella pullorum, and a kit containing the specific primer and application thereof. According to the invention, the primer for specifically amplifying Salmonella pullorum is designed directed at a specific fragment of Salmonella pullorum; a PCR detection method capable of directly detecting Salmonella pullorum in feces, eggs and chicken samples is established; the method has good specificity, high sensitivity and short detection time and rapidly and accurately detect Salmonella pullorum; and with the method, amplification results of 22 common pathogenic Salmonella serotypes and 8 common non-Salmonella pathogenic bacteria are negative, and Escherichia coli can be well distinguished. The invention provides a rapid and effective technical means for the detection of Salmonella pullorum; and the method has the advantages of simple operation, low requirements on equipment and short detection time, and can meet the demand of most poultry breeding factories for rapid detection of Salmonella pullorum.

Description

technical field [0001] The invention relates to a specific primer for detecting Salmonella pullorum and a kit containing the primer, and also relates to a specific PCR method for rapidly detecting Salmonella pullorum using the primer and the kit. The invention belongs to biotechnology detection field, Background technique [0002] Salmonella (Salmonella) is one of the main food-borne pathogens, and its serotypes are numerous. There are more than 2,600 serotypes that have been identified, but only some specific Salmonella serotypes can infect humans and animals. Among them, Salmonella pullorum (S.pullorum) is a host-specific pathogen that seriously affects the development of my country's poultry breeding industry. It has a wide range of transmission and strong pathogenicity. It mainly infects chicks within 21 days of age and can cause white diarrhea. The mortality rate after infection is almost 100%. However, adult chickens usually have no clinical symptoms after being infect...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/68C12Q1/10C12N15/11
CPCC12Q1/689Y02A50/30
Inventor 于申业刘思国曹俊
Owner HARBIN VETERINARY RES INST CHINESE ACADEMY OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap