Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method and application of expression T vector of Bacillus thuringiensis Vip gene

A Bacillus thuringiensis, construction method technology, applied in the field of genetic engineering, can solve the problems of loss of mutants, cumbersome process and the like

Active Publication Date: 2017-12-15
HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0009] The traditional enzyme digestion and ligation of the mutant gene to the expression vector will lose part of the mutant, and it is necessary to transform the cloning host and then transform the expression host, which is a cumbersome process

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method and application of expression T vector of Bacillus thuringiensis Vip gene
  • Construction method and application of expression T vector of Bacillus thuringiensis Vip gene
  • Construction method and application of expression T vector of Bacillus thuringiensis Vip gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0063] A construction method of the expression T carrier of bacillus thuringiensis Vip gene, the construction method is:

[0064] Step 1: Build Linker

[0065] Synthesize two paired nucleotides Linker-F (CACCACGATTCCTATGGAAGGGCCCGCTCGAGAGCCACCGCAATGGTGGG) and Linker-R (GATCCCCACCATTGCGGTGGCTCTCGAGCGGGCCCTTCCAGAGGAATCGTGGTGGTAC) in water respectively, dissolve them in water to a final concentration of 10 μmol / L, mix 20 μL each, denature at 95°C for 5 minutes, and follow the steps below Refolding: 3 minutes at 85°C, 3 minutes at 65°C, 3 minutes at 45°C, 3 minutes at 37°C, 3 minutes at room temperature at 25°C;

[0066] The second step: BamH I, KpnI double digestion of pUC19 plasmid and Linker

[0067] reaction system:

[0068] dna

3 μL

10×digestion buffer

2 μL

Bam H I

1 μL

KpnI

1 μL

Add ddH2O to

20μL

[0069] Reaction conditions: After mixing the reaction system, put it at 37 ℃ for 4 hours, take 5 μl of the digeste...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of gene engineering, and concretely relates to a construction method and an application of an expression T vector of a Bacillus thuringiensis Vip gene. The expression T vector is pAc19-T, the sequence of the expression T vector is represented by SEQ ID.1, the sizes of the successfully constructed vector pAc19-T is 3706 bp, the size of the pAc19-T vector digested by Xcm I is 3055 bp, and the expression T vector can be widely used for the TA cloning of the Bacillus thuringiensis Vip gene fragment, and effectively solves the problems of an error-prone PCR method used for researching the Bacillus thuringiensis Vip protein orthogenesis expression T vector, so the process is greatly simplified, and the efficiency is improved.

Description

Technical field: [0001] The invention belongs to the technical field of genetic engineering, in particular to a construction method and application of a T vector for expressing the Vip gene of Bacillus thuringiensis. Background technique: [0002] Bacillus thuringiensis ( Bacillus thuringiensis , Bt for short) is a Gram-positive bacterium that can produce a variety of proteins with insecticidal activity, such as insecticidal crystal proteins (ICPs) and vegetative insecticidal proteins (VIPs). [0003] At present, the research on the mechanism of action of Cry protein is relatively in-depth. Taking the insecticidal process of 3d-Cry proteins on Lepidoptera insects as a model, first, sensitive larvae ingest Cry protoxin, which is digested into active fragments of about 60 kDa through the action of midgut fluid protease. The activated protein binds to different Cry protein receptors in the insect midgut, inserts into the cell membrane, and forms pores (ie, ion channels) on th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/63C12N15/66C12N15/32
CPCC07K14/325C12N15/63C12N15/66
Inventor 刘明孙海燕李娜韩巍郑树生
Owner HEILONGJIANG BAYI AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com