Supercharge Your Innovation With Domain-Expert AI Agents!

Preparation method of renilla luciferase-carrying duck Tembusu reported virus and product and application thereof

A renilla luciferase and reporter virus technology is applied in the construction of duck Tembusu reporter virus, which can solve the problems of successful construction of no DTMUV virus, and achieve the effects of excellent sensitivity and convenient use.

Active Publication Date: 2017-12-15
SICHUAN AGRI UNIV
View PDF5 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there is no report of the successful construction of the reporter virus of DTMUV at home and abroad

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of renilla luciferase-carrying duck Tembusu reported virus and product and application thereof
  • Preparation method of renilla luciferase-carrying duck Tembusu reported virus and product and application thereof
  • Preparation method of renilla luciferase-carrying duck Tembusu reported virus and product and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] (1) Synthesize the sequence of 5'CS comprising FMDV 2A and synonymous mutation:

[0035] In order to insert the sequence containing FMDV 2A and synonymously mutated 5'CS into the P1 fragment and synonymously mutate the original 5'CS sequence, multiple rounds of fusion PCR amplification were required. In order to reduce the difficulty of fusion PCR, the sequence containing FMDV 2A and synonymous mutation 5'CS was directly sent to the whole gene synthesis, referred to as C26-RLuc-FMDV 2A, the specific sequence is as follows:

[0036] cgttgagcgagttctcaaaaatgaacaacagctgttgaattttgaccttctcaagctggcgggagacgtcgagtccaaccctgggccaatgtctaacaaaaaaccaggaagacccggctcaggccgggttgtgaacatgttgaagcgcggaacgtcccgcggaaatccgctagcgcggataaagaggacgattgatggggtcctgagaggagcaggacccataaggtttgtgctggctctactgactttcttcaagtttacagccctgaggc(SEQ ID NO.1)。

[0037] (2) Amplify Renilla luciferase expression cassette

[0038] The pRL-TK plasmid was used as a template, and RLuc-F and RLuc-R were used as primers for...

Embodiment 2

[0055] Pick a single colony of the correctly sequenced reporter virus plasmid, shake at 120rpm / min at 30°C until the turbidity is appropriate. Use the endotoxin-free plasmid extraction kit to extract the plasmid for later use.

[0056] Using mMESSAGE mMACHINE TM T7Transcription Kit performs in vitro transcription, strictly following the supplier’s recommended procedures, using RNase-free pipette tips and EP tubes, etc.:

[0057] (1) In order to prevent the transcription of an excessively long chain, 10 μg of pACYC RLuc-TMUV plasmid was fully linearized by NotI single enzyme digestion to terminate transcription;

[0058] (2) Preparation of in vitro transcription system:

[0059]

[0060] Then incubate at 37°C for 3h;

[0061] (3) After the transcription is completed, add 1 μl TuRBO DNase, mix well, and incubate at 37°C for 15 minutes;

[0062] (4) Lithium chloride precipitation to recover RNA:

[0063] a) Add 30μl Nuclease-free ddH 2 O and 30 μl LiCl precipitation sol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to an establishment method of a renilla luciferase-carrying duck Tembusu reported virus and a product and application thereof. The establishment method comprises the following steps: restructuring an infectious cloned plasmid containing full-length cDNA of the duck Tembusu virus, inserting a gene of renilla luciferase into a site between 5'UTR and a structural gene of the TMUV virus to establish an infectious cloned plasmid, into which the RLuc gene is inserted, of the full-length TMUV reported virus, then obtaining a transcript of the reported virus by using a high-quality automatically-capped T7 in-vitro transcription kit, and transfecting BHK21 cells to rescue the reported virus. The renilla luciferase is excellent in sensitivity and convenient to use and can be quantitatively detected, so that the replication condition of the virus can be reflected by detecting the activity of the RLuc; and the renilla luciferase-carrying duck Tembusu reported virus can be applied to research in multiple aspects such as the life cycle and the replication mechanism of the TMUV, an anti-TMUV test, interaction between a viral protein and a host and other multi-aspect mechanisms.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a method for constructing a duck Tembusu reporter virus carrying renilla luciferase, and also relates to a product prepared by the method and an application of the product. Background technique [0002] my country is a big poultry raising country in the world, and it is also the largest duck raising country in the world. Since the first outbreak of Duck Tembusuvirus (DTMUV) in 2010, it has caused huge economic losses to the duck industry in my country. Almost all breeds of ducks can be infected with Duck Tembusu virus, including Cherry Valley duck, Peking duck, Shelduck duck, etc. The main clinical symptoms are: increased body temperature, significantly decreased appetite, weakness of limbs, paralysis; Grass-green loose stools and foul-smelling odors; ducklings are characterized by paralysis and head and neck tremors after infection. After the breeding ducks are infected, the charact...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/53C12N7/01C12Q1/70C12Q1/66C12R1/93
CPCC12N7/00C12N15/85C12N2770/24152C12N2800/107C12Q1/02C12Q1/025C12Q1/66G01N2333/185G01N2500/10
Inventor 陈舜贺煜程安春汪铭书
Owner SICHUAN AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More