An artificial transcription activator dcas9-tv and its encoding gene and application

A transcription activator, dcas9-tv technology, applied in genetic engineering, using vectors to introduce foreign genetic material, peptides, etc., can solve the problems of increasing off-target, increasing the complexity of experimental operations, limiting applications, etc., and achieves wide application prospects, transcription The effect of improving activation efficiency and lowering technical threshold

Active Publication Date: 2021-05-07
SUN YAT SEN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

When only a single gRNA is used to bind to the target gene promoter, in most cases the dCas9-VP64 transcriptional activator can only up-regulate the target gene transcription by less than 2 times at most, which cannot meet the needs of target gene transcriptional activation, which greatly limits the application of this technology
But on the one hand, this increases the possibility of off-target, and at the same time increases the complexity of experimental manipulations, and reduces the throughput of the entire transcriptional activation system (i.e., the ability to activate multiple genes simultaneously)
[0006] In summary, there is still a lack of highly efficient artificial transcriptional activators in plants, and it is difficult to achieve effective transcriptional activation of single or multiple endogenous genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An artificial transcription activator dcas9-tv and its encoding gene and application
  • An artificial transcription activator dcas9-tv and its encoding gene and application
  • An artificial transcription activator dcas9-tv and its encoding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Construction of CRISPR / Cas9-derived artificial transcriptional activators

[0046] The codons of the 10th amino acid "D" and the 840th amino acid "H" of pcoCas9 (plant codon-optimized SpCas9) were replaced with the codons of amino acid "A" by PCR site-directed mutagenesis technology to obtain nuclease inactive Cas9, namely dCas9. The primers used are as follows:

[0047] Cas9-D10A-F: GTACTCTATCGGACTTGCTATCGGAACCAACTCTG

[0048] Cas9-D10A-R: CAGAGTTGGTTCCGATAGCAAGTCCGATAGAGTAC

[0049] Cas9-H840A-F: TGATTACGATGTTGATGCTATCGTTCCACAGTCTT

[0050] Cas9-H840A-R: AAGACTGTGGAACGATAGCATCAACATCGTAATCA

[0051] Q5 high-fidelity PCR polymerase was purchased from NEB Company, and the site-directed mutagenesis PCR reaction system was as follows:

[0052]

[0053] The HBT-pcoCas9 plasmid was constructed and preserved by our laboratory. Reaction program: denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 10 min, 16...

Embodiment 2

[0062] Transcriptional activation of Arabidopsis WRKY30 gene based on artificial transcriptional activator dCas9-TV

[0063] (1) Design of Arabidopsis WRKY30 gene promoter target sequence and construction of gRNA expression vector

[0064] Find the promoter sequence of the Arabidopsis WRKY30 gene from the NCBI database, and select the target sequence "AAGAACGAAGAAAGCTGATG" within 200bp upstream of the transcription start site TGG " (the underline is the PAM structure), and design gRNA-WRKY30 accordingly. For this gene, the present invention uses two kinds of expression cassettes AtU6-1:gRNA:TTTTTT and AtU6-26:gRNA:TTTTTT, and its construction all uses the overlapping PCR method , The overlapping sequence is a 20nt target sequence. AtU6-1 and AtU6-26 promoters have been previously cloned by our laboratory. The PCR primers used to construct AtU6-1: gRNA: TTTTTT are as follows:

[0065] U6-1-SacI-F: CGAGAGCTCAGAAATCTCAAAATTCCG

[0066]U6-1-WRKY30-R: CATCAGCTTTCTTCGTTTCTTCAAT...

Embodiment 3

[0098] Transcriptional activation of Arabidopsis RLP23 gene based on artificial transcriptional activator dCas9-TV

[0099] (1) Design of Arabidopsis RLP23 gene promoter target sequence and construction of gRNA expression vector

[0100] Find the promoter sequence of the Arabidopsis RLP23 gene from the NCBI database, and select the target sequence "AAATCCCTTAACGTATAACT" within 200 bp upstream of the transcription start site TGG " (the underline is the PAM structure), and gRNA-RLP23 was designed accordingly. The AtU6-26:gRNA:TTTTTT expression cassette was constructed using the overlapping PCR method, and the overlapping sequence was the 20nt target sequence. The PCR primers used were as follows:

[0101] U6-26-SacI-F: CGAGAGCTCAGCTTTTTTTCTTCTTCT

[0102] U6-26-RLP23-R: AGTTATACGTTAAGGGATTTCAATCACTACTTCGACTCT

[0103] gRNA-RLP23-F:AAATCCCTTAACGTATAACTGTTTTAGAGCTAGAAATA

[0104] gRNA-SacI-R: CGAGAGCTCAAAAAAGCACCGACTCGGTGC

[0105] After the overlapping PCR final products w...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a high-efficiency artificial transcription activator dCas9‑TV, its coding gene and its application. In the present invention, multiple copies of VP64 and TAL transcriptional activation domains are connected to the carboxy-terminal of the nuclease-inactivated Cas9 protein (dCas9) to generate a series of novel artificial transcriptional activators, and dCas9 with the best transcriptional activation activity is screened out -TV. When only one guide RNA (gRNA) was used to target specific gene promoters, dCas9‑TV efficiently activated transcription of endogenous genes in Arabidopsis and rice. When multiple gRNAs are used to target multiple target genes, dCas9‑TV can simultaneously achieve transcriptional activation of multiple genes. In addition, dCas9‑TV was also confirmed to have highly efficient targeted transcriptional activation activity in human cells. The dCas9‑TV / gRNA ribonucleoprotein complex assembled in vitro can also activate the transcriptional activation of Arabidopsis and rice endogenous genes. Based on the above excellent activities, it can be applied to genome genetic screening, biosynthesis pathway modification of metabolites, and crop improvement.

Description

technical field [0001] The invention relates to a high-efficiency artificial transcription activator dCas9-TV and its coding gene and application, belonging to the field of biotechnology, in particular to genetic improvement of crops based on gene overexpression and artificial regulation of eukaryotic cell metabolic pathways. Background technique [0002] Transcription regulation is an important part of eukaryotic gene expression, which can change the level of gene expression by changing the rate of transcription. This process involves the joint participation of many transcriptional regulatory elements. Among them, the transcription activator can promote the interaction between RNA polymerase and the promoter, and increase the transcription level of the target gene. Transcription activator contains DNA-binding domain (DNA-binding domain) and transcription activation domain (transcription activation domain, TAD), the former determines the specificity of transcription activat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N9/22C12N15/62C12N15/82C12N15/113
CPCC12N9/22C12N15/113C12N15/8213C07K2319/71C12N2310/10
Inventor李剑峰黎镇祥张丹丹熊翔宇
OwnerSUN YAT SEN UNIV