High-efficiency artificial activating transcription factor dCas9-TV, and coding gene and applications thereof
A technology of transcription activator and transcription activation, applied in the direction of genetic engineering, using vectors to introduce foreign genetic material, peptides, etc., can solve the problems of increasing off-target, increasing the complexity of experimental operations, limiting applications, etc., and achieves wide application prospects, transcription activation The effect of improving efficiency and lowering technical threshold
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0045] Construction of CRISPR / Cas9-derived artificial transcriptional activators
[0046] The codons of the 10th amino acid "D" and the 840th amino acid "H" of pcoCas9 (plant codon-optimized SpCas9) were replaced with the codons of amino acid "A" by PCR site-directed mutagenesis technology to obtain nuclease inactive Cas9, namely dCas9. The primers used are as follows:
[0047] Cas9-D10A-F: GTACTCTATCGGACTTGCTATCGGAACCAACTCTG
[0048] Cas9-D10A-R: CAGAGTTGGTTCCGATAGCAAGTCCGATAGAGTAC
[0049] Cas9-H840A-F: TGATTACGATGTTGATGCTATCGTTCCACAGTCTT
[0050] Cas9-H840A-R: AAGACTGTGGAACGATAGCATCAACATCGTAATCA
[0051] Q5 high-fidelity PCR polymerase was purchased from NEB Company, and the site-directed mutagenesis PCR reaction system was as follows:
[0052]
[0053] The HBT-pcoCas9 plasmid was constructed and preserved by our laboratory. Reaction program: denaturation at 98°C for 30 s; denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 10 min, 16...
Embodiment 2
[0062] Transcriptional activation of Arabidopsis WRKY30 gene based on artificial transcriptional activator dCas9-TV
[0063] (1) Design of Arabidopsis WRKY30 gene promoter target sequence and construction of gRNA expression vector
[0064] The promoter sequence of the Arabidopsis WRKY30 gene was searched from the NCBI database, and the target sequence "AAGAACGAAGAAAGCTGATGTGG" (the underlined PAM structure) was selected within 200 bp upstream of the transcription start site, and gRNA-WRKY30 was designed accordingly. For this gene, the present invention uses two expression cassettes AtU6-1:gRNA:TTTTTT and AtU6-26:gRNA:TTTTTT, both of which are constructed using the overlapping PCR method, and the overlapping sequence is a 20nt target sequence. AtU6-1 and AtU6-26 promoters have been cloned by our laboratory before. The PCR primers used to construct AtU6-1:gRNA:TTTTTT are as follows:
[0065] U6-1-SacI-F: CGAGAGCTCAGAAATCTCAAAATTCCG
[0066]U6-1-WRKY30-R: CATCAGCTTTCTTCGTTTC...
Embodiment 3
[0098] Transcriptional activation of Arabidopsis RLP23 gene based on artificial transcriptional activator dCas9-TV
[0099] (1) Design of Arabidopsis RLP23 gene promoter target sequence and construction of gRNA expression vector
[0100] Find the promoter sequence of the Arabidopsis RLP23 gene from the NCBI database, and select the target sequence "AAATCCCTTAACGTATAACT" within 200 bp upstream of the transcription start site TGG " (the underline is the PAM structure), and gRNA-RLP23 was designed accordingly. The AtU6-26:gRNA:TTTTTT expression cassette was constructed using the overlapping PCR method, and the overlapping sequence was the 20nt target sequence. The PCR primers used were as follows:
[0101] U6-26-SacI-F: CGAGAGCTCAGCTTTTTTTCTTCTTCT
[0102] U6-26-RLP23-R: AGTTATACGTTAAGGGATTTCAATCACTACTTCGACTCT
[0103] gRNA-RLP23-F:AAATCCCTTAACGTATAACTGTTTTAGAGCTAGAAATA
[0104] gRNA-SacI-R: CGAGAGCTCAAAAAAGCACCGACTCGGTGC
[0105] After the overlapping PCR final products w...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com