Unlock instant, AI-driven research and patent intelligence for your innovation.

Recombinant escherichia coli capable of efficiently producing glucosamine and application thereof

A technology of glucosamine and glucose, applied in the field of bioengineering, can solve the problems of high industrialization cost, low yield, high glucose, etc., and achieve the effects of low cost, increased yield, and high-efficiency expression

Inactive Publication Date: 2018-02-27
JIANGNAN UNIV
View PDF5 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the yields of the above wild-type strains and engineered strains after transformation are not very high, and the fermentation process requires a lot of glucose, and the industrialization cost is high.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant escherichia coli capable of efficiently producing glucosamine and application thereof
  • Recombinant escherichia coli capable of efficiently producing glucosamine and application thereof
  • Recombinant escherichia coli capable of efficiently producing glucosamine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Embodiment 1: Construction of expression vector pTrcHisA-glmS

[0041] The glucosamine synthase gene glmS used in the present invention is derived from E. coli MG1655, which is a commercial strain. Using pTrcHisA as the expression vector. pTrcHisA contains a trc promoter, which can enable the normal expression of the target gene in E. coli MG1655, while the commonly used pET series of plasmids are composed of T7 promoters, which cannot express the target gene in E. coli MG1655, so the pTrcHisA plasmid was selected.

[0042] E.coli MG1655 was inoculated in 25mL LB liquid medium, cultured at 37°C, 200rpm for 12h, the bacteria were collected, and the genomic DNA of the E. coli strain was extracted using a bacterial genome extraction kit.

[0043] According to the published genome information sequence, respectively design sequences such as SEQ ID NO.6 / SEQ ID NO.7 primer pair glmS-S / glmS-A, using the extracted genomic DNA as a template, using standard PCR amplification syst...

Embodiment 2

[0047] Example 2: Construction of expression vector pTrcHisA-glmS-gna1

[0048] The glucosamine acetylase gene gna1 used in the present invention is derived from S.cerevisiae BY4741, and S.cerevisiae BY4741 is inoculated in 25mLYeast Extract Peptone Dextrose Medium (YPD) liquid medium, cultivated at 30°C and 200rpm for 12h, and the bacteria are collected and used The Fungal Genome Extraction Kit extracts genomic DNA from yeast strains.

[0049] According to the published genome information sequence, respectively design sequences such as SEQ ID NO.8 / SEQ ID NO.9 primer pair gna1-S / gna1-A, using the extracted genomic DNA as a template, using standard PCR amplification system and program , to amplify and obtain the gna1 gene.

[0050] gna1-S (SEQ ID NO.8):ACTCGAGATGAGCTTACCCGATGGATTTTATATAAG

[0051] gna1-A (SEQ ID NO.9):AAGCTTCTATTTTCTAATTTGCATTTCCACGC

[0052] The gna1 obtained by PCR amplification was recovered by agarose gel electrophoresis, and the recovered product and th...

Embodiment 3

[0053] Example 3: Construction of the gene nagE genome editing fragment that weakens the acetylglucosamine phosphate transporter

[0054] In order to realize the translation of the acetylglucosamine transporter gene nagE, the initiation codon ATG was optimized by replacing it with TTG, and the genome editing fragment was constructed with the help of Red homologous recombination technology. The gene editing fragments include upstream and downstream homology arm regions, and resistance screening cassettes. Using the E.coli MG1655 genome as a template, design a sequence such as SEQ ID NO.10 / SEQ ID NO.11 primer pair nagE-S1 / nagE-A1 to amplify the nagE gene, and use the plasmid pKD4 as a template to design a sequence such as SEQ ID NO. 12 / SEQID NO.13 primer pair nagE-S2 / nagE-A2 amplification resistance screening gene Kan, and then the above PCR products were recovered by agarose nucleic acid gel electrophoresis, and the recovered nagE gene and Kan were used as templates, NagE-S1 / n...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant escherichia coli capable of efficiently producing glucosamine and application thereof, which belong to the technical field of biological engineering. The invention successfully expresses an E.coli MG1655-sourced glucosamine synthase gene glmS and an S.cerevisiae BY4741-sourced glucosamine acetylase gene gna1 in a host E.coli MG1655, and on the basis, the expression intensities of an acetylglucosamine phosphate transporter gene nagE and a mannose phosphate transporter gene manX are weakened. Obtained genetically engineered strains are fermented in a 5L fermentation tank for 44 hours, the yield of the glucosamine reaches 131.5g / L, and the transformation rate reaches 35.1 percent; the obtained genetically engineered strains are fermented in a 1000L fermentation tank for 44 hours, the yield of the glucosamine reaches 137g / L, and the glucose transformation rate is 37.7 percent.

Description

technical field [0001] The invention relates to a recombinant Escherichia coli for efficiently producing glucosamine and an application thereof, belonging to the technical field of bioengineering. Background technique [0002] Glucosamine (Glucosamine, GlcN), also known as glucosamine or glucosamine, is a compound in which one hydroxyl group of glucose is replaced by an amino group. It is easily soluble in water and hydrophilic solvents. Its derivative N-acetylglucosamine (GlcNAc) GlcN can be obtained by acid hydrolysis. GlcN exists in almost all organisms, including bacteria, yeast, filamentous fungi, plants and animals, and is the main component of glycoproteins and proteoglycans, as well as chitosan and chitin. GlcN has a variety of biological activities and medicinal value. It is widely used clinically for the treatment of osteoarthritis and can inhibit leukemia and cancer cells. In addition, GlcN is also widely used in the field of food health care and is regarded as n...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21C12N15/70C12P19/26C12R1/19
CPCC12N9/1029C12N9/1096C12P19/26C12Y203/01003C12Y206/01016
Inventor 刘立明张权陈修来刘佳罗秋玲
Owner JIANGNAN UNIV