New function of titanium dioxide nanoparticles in inhibiting growth of escherichia coli
A nanoparticle and Escherichia coli technology, which is applied in the direction of nanomedicine, nanotechnology, nanotechnology, etc., can solve the problem of low antibacterial properties of titanium dioxide nanoparticles, and achieve a significant antibacterial effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0019] Antibacterial activity detection of titanium dioxide nanoparticles:
[0020] The activated Escherichia coli was inoculated into a fresh medium at 2% and cultured for 4 hours to grow to the logarithmic growth phase, then 50 microliters of the bacterial solution was diluted 100 times and mixed with the medium and poured onto the plate. Insert the Oxford cup at the same time, add 150 microliters of positive control (ampicillin, 100 ng / microliter), negative control (distilled water), low concentration (20 micrograms of titanium dioxide nanoparticles), medium concentration (200 micrograms of titanium dioxide nanoparticles), For high concentration (2 mg nanoparticles) of the test substance, observe the existence of the inhibition zone after incubation for 16 hours.
Embodiment 2
[0022] Effect of titanium dioxide on target gene expression:
[0023] Titanium dioxide nanoparticles were added to the Escherichia coli liquid culture cultured to the above logarithmic growth phase so that the final concentration reached 50 mg / ml. After continuing to cultivate for 16 hours, the thalline was recovered, and the total mRNA in the cells was extracted using conventional technical means in the art, reverse-transcribed into cDNA, and the expression level of the OmpF gene was carried out using a Cycle480 (Roche) fluorescent quantitative PCR instrument (using SybrGreen dye). quantitative analysis. The PCR conditions used were: pre-denaturation at 95°C for 5 minutes, followed by 40 cycles of amplification at 95°C for 10s, 60°C for 10s, and 72°C for 30s. The primers used were: upstream CCAGGGTAACAACTCTGAAG; downstream GCCGCCAACACGACCAACGA. The obtained quantitative value is the relative ratio of the expression level of OmpF to the internal reference gene GAPDH. After ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
