Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

An isolated Δ9-desaturase gene and its encoded protein from Lygus melanogaster

A technology of 9-des-f and Lygus melanogaster, which can be used in genetic engineering, plant genetic improvement, biocide, etc., and can solve problems such as no clear reports

Inactive Publication Date: 2020-09-29
HUAZHONG AGRI UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] At present, the research on pheromones of Miridae and even Hemiptera insects is still in the stage of identification of pheromone components, and only a few literatures have speculated about the molecular mechanism of pheromone biosynthesis, and no clear reports have been seen.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • An isolated Δ9-desaturase gene and its encoded protein from Lygus melanogaster
  • An isolated Δ9-desaturase gene and its encoded protein from Lygus melanogaster
  • An isolated Δ9-desaturase gene and its encoded protein from Lygus melanogaster

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1: Cloning and analysis of the Δ9-desaturase gene of Lygus melanogaster

[0030] 1. Extraction of total RNA from Lygus melanogaster: Weigh 30 mg of Lygus melanogaster sample and place it in a glass homogenizer, use Promega’s SV total RNA isolation system extraction kit to extract total RNA, refer to the kit manual for detailed steps .

[0031] 2. Synthesis of cDNA: Use PrimeScriptTM RT Master Mix of Treasure Bioengineering Dalian Co., Ltd. to reverse transcribe mRNA to synthesize cDNA template (refer to the instructions provided by Treasure Bioengineering Dalian Co., Ltd. for detailed steps).

[0032] 3. Primer design: The Δ9-desaturase gene nucleic acid sequence (see SEQ ID NO: 1) was obtained by transcriptome sequencing, and primers were designed to verify the predicted open reading frame. Design and synthesize the following primers:

[0033] Upstream primer sequence △9-des-F: 5'-CGGGCATCCGAGATTTCAC-3';

[0034] Downstream primer sequence △9-des-R: 5'-ACAGA...

Embodiment 2

[0039] Example 2: dsRNA synthesis

[0040] 1. Preparation of dsRNA template:

[0041] (1) According to the Δ9-desaturase gene sequence obtained in Example 1, predict the dsRNA region by siDirect version2.0, and use the software Primer Premier5.0 to design specific amplification primers (5'-end plus T7promoter sequence) , for the amplification of the dsRNA fragment of the Δ9-desaturase gene, the designed specific primers are as follows:

[0042] Upstream primer sequence ds△9-des-F: CTATAGCGATGGCCCCCAAC

[0043] Downstream primer sequence ds△9-des-R: GCAATCTCAGAGGGAGCCTG

[0044] The above primers ds△9-des-F and ds△9-des-R were used for PCR amplification, and the PCR reaction system was referred to the Ex Taq enzyme instruction manual of Bao Bioengineering Dalian Co., Ltd.

[0045] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, annealing at 72°C for 2 min, 38 cycles; extension at 72°C for 10 min. After the...

Embodiment 3

[0078] Example 3 Gene silencing efficiency after injection of dsΔ9-desaturase and its effect on pheromone synthesis of Lygus melanogaster

[0079] Using the synthesized dsGFP as a control, the synthesized dsRNA was injected into newly eclovened females from the outermost side of the hind thoracic and abdominal intersegmental membranes of Lygus melanogaster using a microinjector.

[0080] 3, 5, 7, and 10 days after the injection, the fat body and mesostomatous gland tissues of Lygus chinensis were taken respectively, and the total RNA was extracted. Premix ExTaq TM II and Bio-Rad DetectioniQ2System. Detection of the silencing effect of △9-desaturase gene.

[0081] After 7 days of injection treatment, every 5 females of Lygus chinensis were used as a group of odor sources, and dsGFP was used as the control group, and the changes in the ability of females to attract males of Lygus chinensis were detected by Y-type olfactometer .

[0082] Injection treatment for 7-10 days, every...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering of insects and particularly relates to a separated adelphocoris suturalis delta 9-desaturase gene and an encoded protein thereof. The nucleotide sequence of the separated adelphocoris suturalis delta 9-desaturase gene is represented by SEQ ID NO:1, and the encoded protein sequence of the gene is represented by SEQ ID NO:2. The invention further relates to application of the adelphocoris suturalis delta 9-desaturase gene as an RNA interference sequence. The adelphocoris suturalis delta 9-desaturase gene has a good silencing effect in the sequence pair. By injecting the interference sequence, the content of a pheromone component 4-oxo-trans-2-hexenal is obviously increased, the mixing ratio of the pheromone is changed, and the attraction force of females to males is remarkably inhibited. Furthermore, the protein can be applied to the development of biological pheromones or transgenic anti-insect plants or the biologicalprevention and control of adelphocoris suturalis.

Description

technical field [0001] The invention relates to the technical field of insect genetic engineering. Specifically, it relates to an isolated Lygus melanogaster Δ9-desaturase gene and its encoded protein. The invention also includes the application of an RNA interference sequence of the Δ9-desaturase gene of Lygus chinensis, through biological verification, the RNA interference sequence of the Δ9-desaturase gene of the present invention can be used for the development of transgenic insect-resistant plants. Background technique [0002] Adelphocoris suturalis belongs to Hemiptera (Hemiptera: Miridae), and is a polyphagous pest. There are 270 species of host plants in 50 families, and it eats cotton, wheat, soybean and alfalfa ( Jiang Yuying et al., 2015). Since the commercialization of transgenic Bt cotton in 1997, the sharp reduction in the use of chemical pesticides has led to a sharp increase in the population of Lygus stinkbugs in the field, and Lygus melanogaster has grad...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/53C12N9/02C12N15/113A01N57/16A01P7/04A01H5/00A01H6/00
CPCA01N57/16C12N9/0071C12N15/113C12N15/8286C12Y114/19001
Inventor 陈利珍罗静李哲马超金双侠雷朝亮
Owner HUAZHONG AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products