An isolated Δ9-desaturase gene and its encoded protein from Lygus melanogaster
A technology of 9-des-f and Lygus melanogaster, which can be used in genetic engineering, plant genetic improvement, biocide, etc., and can solve problems such as no clear reports
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Example 1: Cloning and analysis of the Δ9-desaturase gene of Lygus melanogaster
[0030] 1. Extraction of total RNA from Lygus melanogaster: Weigh 30 mg of Lygus melanogaster sample and place it in a glass homogenizer, use Promega’s SV total RNA isolation system extraction kit to extract total RNA, refer to the kit manual for detailed steps .
[0031] 2. Synthesis of cDNA: Use PrimeScriptTM RT Master Mix of Treasure Bioengineering Dalian Co., Ltd. to reverse transcribe mRNA to synthesize cDNA template (refer to the instructions provided by Treasure Bioengineering Dalian Co., Ltd. for detailed steps).
[0032] 3. Primer design: The Δ9-desaturase gene nucleic acid sequence (see SEQ ID NO: 1) was obtained by transcriptome sequencing, and primers were designed to verify the predicted open reading frame. Design and synthesize the following primers:
[0033] Upstream primer sequence △9-des-F: 5'-CGGGCATCCGAGATTTCAC-3';
[0034] Downstream primer sequence △9-des-R: 5'-ACAGA...
Embodiment 2
[0039] Example 2: dsRNA synthesis
[0040] 1. Preparation of dsRNA template:
[0041] (1) According to the Δ9-desaturase gene sequence obtained in Example 1, predict the dsRNA region by siDirect version2.0, and use the software Primer Premier5.0 to design specific amplification primers (5'-end plus T7promoter sequence) , for the amplification of the dsRNA fragment of the Δ9-desaturase gene, the designed specific primers are as follows:
[0042] Upstream primer sequence ds△9-des-F: CTATAGCGATGGCCCCCAAC
[0043] Downstream primer sequence ds△9-des-R: GCAATCTCAGAGGGAGCCTG
[0044] The above primers ds△9-des-F and ds△9-des-R were used for PCR amplification, and the PCR reaction system was referred to the Ex Taq enzyme instruction manual of Bao Bioengineering Dalian Co., Ltd.
[0045] PCR reaction program: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 58°C for 30 s, annealing at 72°C for 2 min, 38 cycles; extension at 72°C for 10 min. After the...
Embodiment 3
[0078] Example 3 Gene silencing efficiency after injection of dsΔ9-desaturase and its effect on pheromone synthesis of Lygus melanogaster
[0079] Using the synthesized dsGFP as a control, the synthesized dsRNA was injected into newly eclovened females from the outermost side of the hind thoracic and abdominal intersegmental membranes of Lygus melanogaster using a microinjector.
[0080] 3, 5, 7, and 10 days after the injection, the fat body and mesostomatous gland tissues of Lygus chinensis were taken respectively, and the total RNA was extracted. Premix ExTaq TM II and Bio-Rad DetectioniQ2System. Detection of the silencing effect of △9-desaturase gene.
[0081] After 7 days of injection treatment, every 5 females of Lygus chinensis were used as a group of odor sources, and dsGFP was used as the control group, and the changes in the ability of females to attract males of Lygus chinensis were detected by Y-type olfactometer .
[0082] Injection treatment for 7-10 days, every...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com