High-yield ansamitocin strain for reinforcing transcriptional level and preparation method thereof
An ansamitocin and transcription-level technology, which is applied in the field of biomedicine and can solve the problem of low efficiency of N-position methylation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] This example is a specific process for preparing a mutant strain with overexpression of the gene asm10. Specifically include the following steps:
[0029] Step 1) Plasmid pLQ586 was constructed: Genomic DNA of Actinomyces spp. precious ATCC 31565 was used as a template, and the asm10 fragment (885 bp) was amplified by PCR using primers asm10-F / R, and SpeI / EcoRI were introduced at both ends of the sequence site, and insert the RBS sequence (ATCTGAGTTGAAGAGGTGACGTC) before the start codon. Asm10 (SpeI / EcoRI)) was inserted at the SpeI / EcoRI site of plasmid pDR3-K* to obtain plasmid pLQ586.
[0030] * Each endonuclease recognition site (enzyme cutting site) involved in the present invention is as follows:
[0031]
[0032] The primer sequence used in step 1) is:
[0033]
[0034] *PCR system and conditions used in gene fragment preparation in step 1):
[0035] PCR reaction system: DNA template 30 ng, primer 30 pmol, 50% DMSO 3 mL, 25 mM Mg 2+ 2 mL, buffer 3 mL, ...
Embodiment 2
[0043] This example is a fermentation process for biosynthesizing ansamitocin by a mutant strain overexpressing the gene asm10. The specific steps are as follows: spread the asm10 overexpressed strain on solid YMG medium for activation, and after culturing at 30°C for 2 days, pick a small amount of mycelium and inoculate it into the primary seed medium, at 30°C, 220 r / min 24 h under high temperature; transfer to secondary seed medium at 4% inoculum size, and cultivate at 30°C, 220 r / min for 24 h; transfer to fermentation medium at 10% inoculum amount, at 25°C, 220 After 7 days of fermentation under the condition of r / min, the fermentation broth was collected for extraction and compound detection.
[0044] Table 1 Composition of seed medium and fermentation medium
[0045]
Embodiment 3
[0047] This example is a method for measuring the transcription level of the doubled gene in the gene doubled strain by fluorescent quantitative PCR. (The samples used for RNA extraction are generally stored in Redzol solution. The RNA extraction process requires low temperature, and the centrifugation process is carried out at 4°C and 12000 r / min unless otherwise specified.)
[0048] The specific steps are: take 500 mL of the crushed sample, add 100 mL of chloroform, vortex and mix well, centrifuge for 15 min, draw the supernatant, add 100 mL of absolute ethanol and mix well, then suck the sample into the spin column (Beijing Saibaisheng Gene Technology Co., Ltd. Technology Co., Ltd.), let stand for 2 min, centrifuge for 1 min, discard the liquid, rinse twice with washing buffer (Washing Buffer, Beijing Saibaisheng Gene Technology Co., Ltd.), discard the liquid, put the spin column in the collection tube and continue centrifuging 2 min. Replace with a new collection tube, ad...
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap