Unlock instant, AI-driven research and patent intelligence for your innovation.

Kit used for detecting human KRAS gene mutation and detecting method thereof

A kit and mutation detection technology, applied in the field of molecular biology, can solve the problems of influence, high cost, unsuitable use, etc., and achieve the effects of convenient use, not easy to contaminate, and simple and reasonable structure design.

Inactive Publication Date: 2018-04-13
SHANGHAI PERSONAL BIOTECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0011] Three EGFR-TKIs (gefitinib / Iressa, erlotinib / Tarceva, and Camino) are currently the main drugs for molecularly targeted therapy in NSCLC, but in different patients EGFR- Efficacy of TKIs varies widely
Among them, the sanger sequencing method can directly obtain the mutation information of the sample through sequencing, but this method requires the sample to be tumor tissue, and the sensitivity is not high. It can only detect mutations with a mutation frequency of more than 20%, which is easily affected by background DNA. For other samples than tumor tissue
In addition to the direct sequencing method, the PCR-SSCP and PCR-RFLP methods are only used for the detection of tumor tissues, and there is no introduction of detection in other specimens
High-throughput sequencing takes a long time and costs a lot
Digital PCR has high sensitivity, but low throughput and high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit used for detecting human KRAS gene mutation and detecting method thereof
  • Kit used for detecting human KRAS gene mutation and detecting method thereof
  • Kit used for detecting human KRAS gene mutation and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] (1) Mutation detection reaction primers and MGB probes are as follows:

[0056] G12C-F: AATATAAACTTGTGGTAGTTGGAGCAT;

[0057] G12S-F AATATAAACTTGTGGTAGTTGGAGCGA;

[0058] G12R-F AATATAAACTTGTGGTAGTTGGAGCAC;

[0059] G12V-F ATATAAACTTGTGGTAGTTGGAGCTCT;

[0060] G12D-F AAACTTGTGGTAGTTGGAGCGGA;

[0061] G12A-F AACTTGTGGTAGTTGGAGCTTC;

[0062] G13D-F GTGGTAGTTGGAGCTGGAGA;

[0063] KRAS-R CATATTCGTCCACAAAATGATTCTG;

[0064] MGB-KRAS FAM-CTGTATCGTCAAGGCACT-MGB;

[0065] (2) Internal reference reaction primers and MGB probes are as follows:

[0066] KRAS-F GACTGAATATAAACTTGTGGTAGTTGGA;

[0067] KRAS-R CATATTCGTCCACAAAATGATTCTG;

[0068] MGB-KRAS FAM-CTGTATCGTCAAGGCACT-MGB.

[0069] Among them, F: forward primer, R: reverse primer.

[0070] 1. Extract sample DNA:

[0071] 1. Sample Processing

[0072] a. Paraffin section: Take 5-8 paraffin sections (5-10 μm thick, 1×1 cm2 size).

[0073] b. Paraffin block: scrape about 30 mg of tissue sample with a scalpel (remove...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a kit used for detecting human KRAS gene mutation and a detecting method thereof. The kit comprises a mutation detecting reaction primer and an inner reference reaction primer. The kit used for detecting the human KRAS gene mutation disclosed by the invention is designed based on an ARMS-PCR experimental method, is simple and reasonable in structural design and is convenient to use, and has the advantages of being high in sensitivity, strong in specificity, short in time consumption and the like while being used for detecting KRAS gene mutation.

Description

technical field [0001] The invention relates to a kit for detecting human KRAS gene mutation and a detection method thereof, belonging to the field of molecular biology. Background technique [0002] 1) Clinical significance of KRAS gene mutation in colorectal cancer [0003] In recent years, with the continuous improvement of people's living standards, changes in eating habits and dietary structure, and population aging, the incidence and mortality of colorectal cancer (CRC) in my country have maintained an upward trend. Among them, the incidence of colon cancer increased significantly. Most patients are already in the middle and late stages when they are discovered. The incidence of colorectal cancer is 221,000, the mortality rate is 110,000, and the 5-year survival rate is 63.7%. [0004] KRAS is a key downstream regulator in the EGFR (epidermal growth factor receptor) signaling pathway, which is involved in the regulation of cell growth and plays an important role in ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6858C12N15/11
CPCC12Q1/6858C12Q2535/137C12Q2531/113C12Q2545/101
Inventor 汪元涛朱月艳孙子奎
Owner SHANGHAI PERSONAL BIOTECH