Application of gibberellin transporter gene OsNPF3.1 in increasing paddy rice output

A gene and rice technology, applied in the application field of gibberellin transport gene OsNPF3.1 in improving rice yield, can solve the problem that there is no report on the biological impact of rice, and achieve the effect of increasing yield

Active Publication Date: 2018-05-04
WUHAN INST OF BIOENG
View PDF1 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Studies have shown that rice OsNPF3.1 protein can transport gibberellins [Tal I, Zhang Y, M E, etal.The Arabidopsis NPF3protein is a GA transporter.Nature Communications,2016,7:11486], but so far, there is no report on the biological impact of the OsNPF3.1 gene on rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of gibberellin transporter gene OsNPF3.1 in increasing paddy rice output
  • Application of gibberellin transporter gene OsNPF3.1 in increasing paddy rice output
  • Application of gibberellin transporter gene OsNPF3.1 in increasing paddy rice output

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Construction of embodiment 1 OsNPF3.1 gene overexpression plant

[0025] Extract the RNA of rice Zhonghua 11 and reverse transcribe it into cDNA, using the primer pair:

[0026] F1: 5'- AGATCT ATGGCGGAGGAGGAGGAGGCGAAGAAGA-3' (Bgl II),

[0027] R1: 5'- CTTAAG TCAATGACTCAAAGGTGAAGCCTT-3' (Afl II);

[0028] After the cDNA of the OsNPF3.1 gene was amplified by PCR, it was digested with Bgl II and Afl II and then ligated into the pCAMBIA-1301 vector (the pCAMBIA-1301 vector was purchased from Cambia Company) to construct the overexpression vector OsNPF3 of the OsNPF3.1 gene. 1-p1301. Using the genetic transformation method mediated by Agrobacterium EHA105, the overexpression vector was introduced into the normal rice variety Zhonghua 11.

[0029] Transplant all the obtained transgenic seedlings into baskets with soil, water and fertilize them regularly, and plant them in the field when the seedlings grow about 10cm in height. After the seedlings grow up, extract genom...

Embodiment 2

[0033] The acquisition of embodiment 2 OsNPF3.1 gene mutant plant

[0034] F3: ACCACCCTCACCAACTTCGG CGG ,

[0035] F4: TCCGCCATGACCCCGCTCAT CGG .

[0036] Using the above two target sequences, the gene knockout vector OsNPF3.1-C of the OsNPF3.1 gene was constructed (for the method refer to Ma X et al, A robust CRISPR / Cas9 system for convenient, high-efficiency multiplex genome editing in monocot and dicot plants. Mol Plant. 2015, 8(8):1274-1284). The genetic transformation method mediated by Agrobacterium EHA105 was used to introduce the gene knockout expression vector into the normal japonica rice variety Zhonghua 11. The mutant plants were sequenced in the T0 generation to confirm that the gene had been knocked out, and continued to propagate until the T1 generation to obtain the mutant plants of the OsNPF3.1 gene. The number of tillers in the OsNPF3.1 mutant plants was much more than that in the control Zhonghua 11 plants, and the difference was significant, as shown...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an application of a gibberellin transporter gene OsNPF3.1 in increasing the paddy rice output, and belongs to the field of plant gene engineering. The amino acid sequence of OsNPF3.1 coded protein is represented by SEQ ID No.1, and the cDNA sequence is represented by SEQ ID No.2. By constructing a paddy rice OsNPF3.1 gene over-expression plant and an OsNPF3.1 gene mutant plant, people find that by losing the expression of OsNPF3.1 gene, the tiller number and effective spike number of normal paddy rice are increased, filled grain number and output of a single plant are increased, and the output of a single paddy rice plant is reduced by increasing the expression of OsNPF3.1 gene. OsNPF3.1 gene can be used to increase the paddy rice yield. OsNPF3.1 gene has an important application value in aspects such as influence of nitrogen in plant growth, paddy rice plant type improvement, and the like.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, and in particular relates to the application of gibberellin transport gene OsNPF3.1 in improving rice yield. Background technique [0002] Gibberellins are a kind of diterpene acid compounds. As plant hormones, they can not only regulate the expression of many genes in plants, but also affect various stages of the life cycle of higher plants, such as seed germination, stem elongation, induction and development of flower organs , seed and fruit formation, etc. Gibberellin biosynthesis is clearly organ-specific and controlled by developmental stage. [0003] The main way of gibberellin biosynthesis is to control the expression of genes related to gibberellin synthesis and decomposition. For example, the main control point is the three dioxygenases (GA20ox, GA2ox and GA3ox) that catalyze GA metabolism in the later stage [Xing Chao, Chen Yongsheng, Li Yue, etc. Gibberellin metabolism and in...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K14/415C12N15/29A01H5/00A01H6/46
CPCC07K14/415C12N15/8213C12N15/8261
Inventor方中明朱炜黄玮婷吕凯汪杰
OwnerWUHAN INST OF BIOENG