Pezicula ericae strain with plant growth promoting effect and application thereof

An endophytic fungus and blueberry technology, applied in the biological field, can solve problems such as lack of strains, and achieve the effects of promoting growth, easy industrial production, and good application prospects.

Active Publication Date: 2018-05-04
SOUTH CHINA AGRI UNIV
View PDF3 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Therefore, it is a good way to use mycorrhizal technology to improve the cultivation and planting conditions of blueberries in South China. However, at present, there is a serious sho

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pezicula ericae strain with plant growth promoting effect and application thereof
  • Pezicula ericae strain with plant growth promoting effect and application thereof
  • Pezicula ericae strain with plant growth promoting effect and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0024] Example 1: Isolation and screening of blueberry endophytic fungal strain 3-41

[0025] 1. Strain isolation

[0026] The sampling locations were Lijiang City, Yulong Naxi Autonomous County, Ludian Township, and Sanjia Village, Yunnan Province in Southwest China. The site type is mountain type, the soil type is forest soil, the geographical range is N26°45′58″~N27°14′45″, E99°34′37″~E100°17′46″, and the altitude range is 2016 m~2647 m. The collected samples were wild blueberry Bilberry yunnanensis ( V.duclouxii (Lev.l) Hand.-Mazz.) and crow fruit ( V.fragile Franc-h.) Root system attached to soil.

[0027] After being brought back to the laboratory, the root samples were first rinsed with tap water for 1 h, and rinsed with 30% H in an ultra-clean bench. 2 o 2 Treat the surface for 5-7 minutes for surface sterilization, then wash twice with sterile water, cut the hairy roots into 1-2 mm long root segments; put the root segments into a sufficient amount of PDA (con...

Embodiment 2

[0044]Example 2: Identification of blueberry endophytic fungus strain 3-41

[0045] 1. Morphological identification

[0046] The mycelium of the strain has septa and does not produce sporulation; the colonies on the PDA plate are irregular, flat, spotted and dense, the color is light brown, and the edge is white (attached figure 2 ).

[0047] 2. Molecular identification

[0048] In this study, the Genomic DNA Extraction Kit of Tiangen Plant was used to extract the genomic DNA of the fungus; ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers were used to amplify the ITS segment of the fungal rRNA gene. And sequence the amplified ITS segment.

[0049] The full length of the fungal ribosomal deoxyribonucleic acid internal transcriptional spacer sequence of the strain is shown in SEQ ID NO: 1:

[0050] ACCTGCGGAGGGATCATTACAGAGACTCTGCCCTTTGGGTAGACCTCCCACCCTGTGTCGTTATACCTTCGTTGCTTTGGCGGGCCGCGGGGCCCCGGCCCCGCCCCTGGCTCCGGCTAGGGCGCGCCCGCCAGAGGACCTCAAAACCTGAATGT...

Embodiment 3

[0053] Example 3: Research on the inoculation effect of blueberry endophytic fungus strain 3-41 on blueberry potted seedlings

[0054] 1. Test plants

[0055] "Blue Rain" blueberry (Bluerain) tissue culture seedlings have been cultivated on moss substrates for 8 months (2015.11~2016.06).

[0056] 2. Preparation of strain 3-41 liquid bacterial agent

[0057] Select the PDA plate of strain 3-41 (25°C dark culture for 4 weeks), pick the hyphae growing vigorously at the edge of the colony, and inoculate it into a Erlenmeyer flask filled with 70 ml of PDA culture solution. Wrap it in a black cloth on a shaker, at 25°C, 120 r min -1 Cultured for 2 weeks.

[0058] 3. Inoculation method

[0059] Using root dipping method, strain 3-41 is a filamentous fungus, and the mycelium of shaking fungus fermentation tends to aggregate into large spherical fungal clusters, so before inoculation, it was treated with a magnetic stirrer for 30 minutes to break the mycelium clusters before dippin...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a pezicula ericae strain with a plant growth promoting effect and application thereof. The pezicula ericae functional strain 3-41 belongs to Dermateaceae in Bacteroidetes. Thetaxonomy name of the strain is pezicula ericae strain 3-41 (Pezicula ericae being equal to Cryptosporiopsis ericae). The strain is preserved in Guangdong province microbe bacterial preservation centeron June 1, 2017, and has the preservation code being GDMCC No.60283. The pezicula ericae functional strain 3-41 is obtained through being separated from wild blueberry root systems; after the strainis inoculated into the culture variety of the blueberry 'Lanyu' pot plant seedlings, the blueberry root systems can be infected; the strain mainly infects the skin and the cortical layer cells; the mode belongs to a typical endophytic fungi fixed planting mode. In addition, the blueberry potted plant inoculation tests show that the inoculation strain 3-41 obviously promotes the growth of the overground parts of the planted blueberries; the pure culture can be realized; the industrial production can be easily realized; good application prospects are realized.

Description

technical field [0001] The invention relates to the field of biotechnology, and more specifically relates to a blueberry endophytic fungus capable of promoting growth and its application. Background technique [0002] Blueberry, scientific name lingonberry, belongs to the genus Vaccinium (Ericaceae) Vaccinium ) is a perennial shrub, which is an emerging small berry tree species with high economic value and broad development prospects. my country is rich in wild blueberry resources, but for commercially cultivated blueberry varieties, it has strict requirements on soil conditions, prefers acidic (pH 4.5-5.5) and high organic matter soil, and the cultivation area in my country is relatively small. At present, my country's blueberry industry is developing rapidly, and commercial cultivation areas are constantly moving southward. Except for the main old production areas such as Changbai Mountain, Liaodong Peninsula, Jiaodong Peninsula, Yangtze River Basin and Southwest producti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N1/14A01N63/04A01P21/00C05F11/08C12R1/645
CPCA01N63/30C05F11/08C12N1/145C12R2001/645
Inventor 姚青陈猛周杨朱红惠
Owner SOUTH CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap