Pezicula ericae strain with plant growth promoting effect and application thereof
An endophytic fungus and blueberry technology, applied in the biological field, can solve problems such as lack of strains, and achieve the effects of promoting growth, easy industrial production, and good application prospects.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0024] Example 1: Isolation and screening of blueberry endophytic fungal strain 3-41
[0025] 1. Strain isolation
[0026] The sampling locations were Lijiang City, Yulong Naxi Autonomous County, Ludian Township, and Sanjia Village, Yunnan Province in Southwest China. The site type is mountain type, the soil type is forest soil, the geographical range is N26°45′58″~N27°14′45″, E99°34′37″~E100°17′46″, and the altitude range is 2016 m~2647 m. The collected samples were wild blueberry Bilberry yunnanensis ( V.duclouxii (Lev.l) Hand.-Mazz.) and crow fruit ( V.fragile Franc-h.) Root system attached to soil.
[0027] After being brought back to the laboratory, the root samples were first rinsed with tap water for 1 h, and rinsed with 30% H in an ultra-clean bench. 2 o 2 Treat the surface for 5-7 minutes for surface sterilization, then wash twice with sterile water, cut the hairy roots into 1-2 mm long root segments; put the root segments into a sufficient amount of PDA (con...
Embodiment 2
[0044]Example 2: Identification of blueberry endophytic fungus strain 3-41
[0045] 1. Morphological identification
[0046] The mycelium of the strain has septa and does not produce sporulation; the colonies on the PDA plate are irregular, flat, spotted and dense, the color is light brown, and the edge is white (attached figure 2 ).
[0047] 2. Molecular identification
[0048] In this study, the Genomic DNA Extraction Kit of Tiangen Plant was used to extract the genomic DNA of the fungus; ITS1-F (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATATGC) primers were used to amplify the ITS segment of the fungal rRNA gene. And sequence the amplified ITS segment.
[0049] The full length of the fungal ribosomal deoxyribonucleic acid internal transcriptional spacer sequence of the strain is shown in SEQ ID NO: 1:
[0050] ACCTGCGGAGGGATCATTACAGAGACTCTGCCCTTTGGGTAGACCTCCCACCCTGTGTCGTTATACCTTCGTTGCTTTGGCGGGCCGCGGGGCCCCGGCCCCGCCCCTGGCTCCGGCTAGGGCGCGCCCGCCAGAGGACCTCAAAACCTGAATGT...
Embodiment 3
[0053] Example 3: Research on the inoculation effect of blueberry endophytic fungus strain 3-41 on blueberry potted seedlings
[0054] 1. Test plants
[0055] "Blue Rain" blueberry (Bluerain) tissue culture seedlings have been cultivated on moss substrates for 8 months (2015.11~2016.06).
[0056] 2. Preparation of strain 3-41 liquid bacterial agent
[0057] Select the PDA plate of strain 3-41 (25°C dark culture for 4 weeks), pick the hyphae growing vigorously at the edge of the colony, and inoculate it into a Erlenmeyer flask filled with 70 ml of PDA culture solution. Wrap it in a black cloth on a shaker, at 25°C, 120 r min -1 Cultured for 2 weeks.
[0058] 3. Inoculation method
[0059] Using root dipping method, strain 3-41 is a filamentous fungus, and the mycelium of shaking fungus fermentation tends to aggregate into large spherical fungal clusters, so before inoculation, it was treated with a magnetic stirrer for 30 minutes to break the mycelium clusters before dippin...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


