Replicating type recombinant adenovirus HAdV-5 carrier system and application thereof
A technology of recombinant adenovirus and vector system, which is applied in the field of replicative recombinant adenovirus HAdV-5 vector system, can solve the problem that the virus cannot replicate, and achieve the effect of wide application
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Embodiment 1, construction of backbone plasmid pKAd5
[0054] The schematic diagram of the construction of the backbone plasmid pKAd5 is shown in figure 1 . Under standard polymerase chain reaction (PCR) conditions, using the pShuttle-CMV plasmid (purchased from Stratagene) as a template, 1710KAd5F: caatccaaaa taaggtatattattgatgat g ttaattaa g atcccgagcg gtatcag (the underline indicates the PacI restriction site), 1710KAd5R: aatccaaaat aaggtatatt attgatgatg ttaattaa tg gaacaacact caaccctat (the underline indicates the PacI restriction site) (the above primer was synthesized by BGI) was used as primer to amplify the 2540bp fragment ORI-KAN (SEQ ID NO: 2). About 30 bp at both ends of this fragment are identical to the ITR sequence of HAdV-5 genome. Mix the ORI-KAN fragment recovered by electrophoresis with wild-type HAdV-5 (VR-1516, purchased from ATCC) genomic DNA (see Genbank accession number: AY339865 for the sequence), and then add an equal volume of DNA assembly...
Embodiment 2
[0056] Embodiment 2, construction of intermediate plasmid pMDXE3YA
[0057] In order to facilitate the transformation of the adenovirus E3 region, the NdeI fragment containing the E3 region was isolated from the backbone plasmid pKAd5 constructed in Example 1, and E3 was replaced with the YFP coding region and the SV40 polyA signal region, and the plasmid obtained after the replacement was named is pMDXE3YA.
[0058] figure 2 A schematic diagram of the construction of the intermediate plasmid pMDXE3GA is shown.
[0059] The construction process of the intermediate plasmid pMDXE3GA is as follows:
[0060] 1) NdeI / EcoRI double digestion of the backbone plasmid pKAd5 constructed in Example 1, electrophoresis recovery of 7776 bp fragment (NdeI-EcoRI, the sequence can be found in SEQ ID NO: 3, SEQ ID NO: 3 is due to retaining the complete NdeI site and EcoRI site point, actually 7783bp).
[0061] 2) Using the pMD-18T plasmid as a template (purchased from Takara Company), using...
Embodiment 3
[0064] Embodiment 3, construction of shuttle plasmid pKNXE3M
[0065] The target gene replacement operation on the intermediate plasmid pMDXE3YA involves multi-step PCR and DNA assembly, which is cumbersome. In order to further simplify the cloning of the target gene, the target gene region of the E3 region was isolated again from the intermediate plasmid pMDXE3YA, and a multiple cloning site was added to construct a smaller shuttle plasmid pKNXE3M. image 3 A schematic diagram of the construction of the shuttle plasmid pKNXE3M is shown.
[0066] The construction method of the shuttle plasmid pKNXE3M is as follows: with pmCherry-N1 plasmid (purchased from Clontech Company) as template, with 1712KNEOf:ggcc gaattc cacttttcgg ggaaatgtgc (the underline indicates the EcoRI restriction site) and 1712KNEOr: ggcc gaattc cgcaggaaag aacatgtgag (the underline indicates the EcoRI restriction site) is used as a primer to amplify the 2600bp fragment, after electrophoresis recovery, it...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


