Primer-probe composition for detecting PIK3CA gene at E545K site and detecting method thereof

A technology of primer probe and composition, which is applied in the fields of medicine and biology, can solve problems such as lack of low investment, and achieve the effects of optimizing annealing temperature, improving sensitivity and accuracy, and optimizing the number of PCR cycles

Pending Publication Date: 2018-07-24
江西海普洛斯生物科技有限公司
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] In summary, detection technology based on circulating tumor DNA has become the focus, but there is still a lack of low-input, high-sensitivity, and high-accuracy mutant DNA detection technology to detect tumor PIK3CA E545K. ddPCR technology can achieve low investment, high sensitivity, high Accurate mutation DNA detection, developed a ddPCR detection method for the weight of PIK3CA gene and its detection probe primer composition, used to detect the E545K site mutation of PIK3CA gene, so as to improve the pertinence of clinical treatment and guide the development of targeted drugs Reasonable use can avoid delays in patients' condition caused by ineffective or improper treatment, reduce treatment risks, and have broad application prospects and market value

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer-probe composition for detecting PIK3CA gene at E545K site and detecting method thereof
  • Primer-probe composition for detecting PIK3CA gene at E545K site and detecting method thereof
  • Primer-probe composition for detecting PIK3CA gene at E545K site and detecting method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Assembly of the kit

[0066] (1) Design of probes and primers: The present invention designs specific primers for the upstream and downstream of the PIK3CA E545K target region; the Taqman probe method is used for design, and corresponding mutant and wild-type sequences are designed for PIK3CA E545K mutant and wild-type sequences. Type probe, as follows;

[0067] The specific amplification of the upstream and downstream primers for PIK3CA E545K are as follows:

[0068] SEQ ID NO: 1CAGCTCAAAGCAATTTCTAC;

[0069] SEQ ID NO: 2CACTTACCTGTGACTCCAT;

[0070] The mutant fluorescent detection probe includes FAM fluorophore, mutation site binding sequence, MGB modification group and NFQ quenching group in sequence from 5'end to 3'end. This probe will interact with the gene mutant when annealed. Site binding

[0071] The specific sequence of the mutant probe is as follows:

[0072] E545K-TT:

[0073] SEQ ID NO.3 is 5’-FAM-CTGAAATCACTAAGCAGGAGA-MGB-NFQ;

[0074] The wild-type fluores...

Embodiment 2

[0080] Example 2 Extraction of cfDNA

[0081] 1. Take 2 mL of peripheral blood and process it within 4 hours of obtaining blood, including the following steps:

[0082] (1) Centrifuge the peripheral blood for 10 min at 4°C at a speed of 1600g to separate into blood cells and plasma (supernatant), and store the blood cells at -80°C;

[0083] (2) Centrifuge the plasma sample for the second time, centrifuge at 16000g for 10 minutes at 4°C, transfer the supernatant to a preservation tube, and store at -80°C;

[0084] 2. Use nucleic acid extraction or purification (ZD-YL-Midi-40) for cfDNA extraction. The extraction steps are as follows:

[0085] (1) Take a clean 10mL centrifuge tube, add 10μL of proteinase K, then add 2mL of the plasma collected in step 1 and 2mL of solution GH, vortex and mix for 15s, then incubate in a constant temperature water bath at 37°C for 10min;

[0086] (2) Add 2 mL of isopropanol (plasma: GH: isopropanol = 1:1:1) to the above mixture, vortex thoroughly (this step ...

Embodiment 3

[0097] Example 3 Detection of PIK3CA E545K locus of ctDNA extracted from peripheral blood of patients with lung cancer

[0098] 1. Prepare the reaction system:

[0099] (1) Design of probes and primers: The present invention designs specific primers for the upstream and downstream of the PIK3CA E545K target region; the Taqman probe method is used for design, and corresponding mutant and wild-type sequences are designed for PIK3CA E545K mutant and wild-type sequences. Type probe, as follows;

[0100] The specific amplification of the upstream and downstream primers for PIK3CA E545K are as follows:

[0101] SEQ ID NO: 1CAGCTCAAAGCAATTTCTAC;

[0102] SEQ ID NO: 2CACTTACCTGTGACTCCAT;

[0103] The mutant fluorescent detection probe includes FAM fluorophore, mutation site binding sequence, MGB modification group and NFQ quenching group in sequence from 5'end to 3'end. This probe will interact with the gene mutant when annealed. Site binding

[0104] The specific sequence of the mutant probe i...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer-probe composition for detecting a PIK3CA gene at the E545K site and a detecting method thereof. The primer-probe composition comprises specific primers SEQ ID NO.1-2 aiming at the PIK3CA gene at the E545K site, a mutant probe SEQ ID NO.3 aiming at the PIK3CA gene at the E545K site and a wild probe SEQ ID NO.4 aiming at the PIK3CA gene at the E545K site, by designingthe primers and modifying the probes aiming at the specific area of the E545K site, the primers and the probes are matched with one another, ddPCR and the primer-probe composition with the high specificity are combined to optimize extraction of cfDNA, recurring number and annealing temperature of PCR, each step synergizes and interacts to improve the accuracy, the stability and the sensitivity ofdetection ultimately, and the primer-probe composition and the detecting method thereof have wide application prospects and market value.

Description

Technical field [0001] The present invention relates to the fields of medicine and biotechnology, in particular to a primer probe composition for detecting PIK3CA gene E545K and a detection method thereof. Background technique [0002] The PIK3CA gene was detected by Volinia in 1994 using in situ hybridization. It is located at 3q26.3, is 34kb long, contains 21 exons, and encodes 1068 amino acids. This group of amino acids produces a set of 124kD proteins. PIK3CA encodes the p110 catalytic subunit of class I phosphatidylino-sitol 3-kinases (PI3Ks), namely PI3Kp110a. Studies have found that PIK3CA is an oncogene. Under physiological conditions, the PIK3CA gene is expressed in normal brain, lung, breast, gastrointestinal, cervical, ovarian and other tissues, and has many important physiological functions in regulating somatic cell proliferation, differentiation, and survival. It is functional, but mostly exists in an inactive form and is usually not easy to detect. After its mutat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6886C12Q1/686C12N15/11
CPCC12Q1/686C12Q1/6886C12Q2600/106C12Q2600/156C12Q2563/159
Inventor刘园园文明新张晓妮陈飞
Owner江西海普洛斯生物科技有限公司