Drug used for preventing Mycobacterium tuberculosis and Mycobacterium tuberculosis infection, and applications thereof

A Mycobacterium tuberculosis and anti-tuberculosis technology, applied in the field of biomedicine, can solve the problems of undiscovered polypeptide drugs

Inactive Publication Date: 2018-07-31
PROTEIN DESIGN LAB LTD
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The recombinant polypeptide drug has the characteristics of strong targeting, safety and high efficiency, and is not easy to produce drug resistance, but it is not found in the patent that the polypeptide drug has any effect on the anti-tuberculosis and its infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Drug used for preventing Mycobacterium tuberculosis and Mycobacterium tuberculosis infection, and applications thereof
  • Drug used for preventing Mycobacterium tuberculosis and Mycobacterium tuberculosis infection, and applications thereof
  • Drug used for preventing Mycobacterium tuberculosis and Mycobacterium tuberculosis infection, and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1. Action molecule is selected colistin Ia, prepares recombinant polypeptide

[0055] The original plasmid is pSELECT loaded with colicin and immunity protein genes TM -1 plasmid (8.3kb). Double-stranded oligonucleotide point mutation technology (QuickChange TM Kit, Strategene Company) will encode the gene fragment of the antibody mimetic: 5-tcttattggctgcattggat taaacagaga cctggtcagg gactgtggatcggatctcagtccacgcatg tgccgagaacc-3 (Seq ID No.1) or 5-tcttattggc tgcattggattaaacagaga cctggtcagg gactgtggat cggaaccaga ccggt3gcata cg) into (Seqaccaga ccggt3gcata cg) On the 626 position of the colicin polypeptide gene, obtain the mutant plasmid pBHC-PorA1 and pBHC-PorA2 (such as figure 1 - figure 2 shown). The mutant plasmid was transfected into E.coli BL-21 engineering bacteria to prepare new antibiotics.

[0056] The mutation program was carried out according to the Strategene QuickChange SiteDirected Mutagenesis Kit (catalog#200518) kit manual, namely:

[00...

experiment example 1

[0102] Experimental Example 1 Contrastive Experiment on the Minimum Inhibitory Concentration of Lethal Drug-resistant Strains

[0103] Experimental strain:

[0104] Susceptible strains: Mtb Erdman is susceptible to current anti-tuberculosis drugs, SUNY Upstate Medical University

[0105] Drug-resistant strains: PUMC-94789 is a strain of the Beijing genotype, resistant to isoniazid and rifampicin, with the classic isoniazid-resistant katG315 gene mutation and rpoB531,526 gene mutation resistant to rifampicin, PUMC-94789 The virulence is stronger, and its LD50 mouse survival period is 7 days (the tuberculosis standard strain H37Rv survival period is 14 days). Peking Union Medical College Peking Union Medical College.

[0106] 506 strains of multidrug-resistant tuberculosis (MDR-TB) were provided by the National Laboratory of Tuberculosis Reference, China CDC.

[0107] The above-mentioned strains are well-known strains, and the applicant's laboratory also preserves them. An ap...

experiment example 2

[0122] Experimental Example 2 Counting of Bacterial Colonies in the Lungs of Mouse Pulmonary Tuberculosis Infection Model

[0123] Female BLAB / c mice were inoculated nasally with 6.8x 10 2 CFU Mtb Erdman tuberculosis;

[0124] Each group of 6 rats was divided into five groups: early control group, late control group, isoniazid group, low-dose pheromone group, high-dose pheromycin group;

[0125] After 21 days of infection, mice in each group were treated as follows:

[0126] Early control group and late control group were intraperitoneally injected with normal saline;

[0127] The isoniazid group was given oral isoniazid 183μmol / kg / d (25mg / kg / d);

[0128] Low-dose pheromycin group and high-dose pheromycin group were injected intraperitoneally with 0.286 or 0.572 μmol / kg / d (20 or 40 mg / kg / d) pheromone, respectively.

[0129] Four weeks later, the right lung was removed, ground, homogenized and cultured to count tuberculosis colonies. The statistical results were as follows:...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
purityaaaaaaaaaa
Login to View More

Abstract

The invention discloses a drug used for preventing Mycobacterium tuberculosis and Mycobacterium tuberculosis infection, and applications thereof, and belongs to the pharmaceutical field. All the active components or a part of the active components of the drug are bacteriocin such as colicins E1, Ia, Ib, A, B, N, or recombinant polypeptides composed of aqueous channel structural domains, and peptide chain carboxyl terminal connected antibody analog polypeptides of the colicines. The drug possesses high efficiency killing effect on multi-drug resistant tuberculosis, and can be used for curing macaques infected by fatal drug-resistant tuberculosis bacterial strains.

Description

technical field [0001] The invention relates to the field of biomedicine, in particular to a drug against Mycobacterium tuberculosis and its infection and its application Background technique [0002] Since penicillin and other antibiotics were put into use, countless lives have been saved, but with the widespread use of antibiotics, more and more pathogenic bacteria have developed drug resistance, and existing antibiotics are gradually ineffective against these drug-resistant pathogenic bacteria. According to relevant reports published by the U.S. Centers for Disease Control and Prevention (CDC) over the years, it is predicted that in another 10 to 20 years, these antibiotics may be completely ineffective, resulting in no medicine available. [0003] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis complex (Mycobacterium tuberculosis complex, referred to as Mycobacterium tuberculosis or Mycobacterium tuberculosis). 80-90% of the total. It ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C07K16/12C07K19/00A61K47/68A61K47/42A61K48/00A61K38/16A61P31/06
CPCA61K38/164A61K47/42A61K48/0008C07K14/245C07K16/1289C07K2317/565C07K2317/567C07K2319/33C07K2319/74A61K38/16A61K48/00A61K47/68A61P31/06C07K16/12C07K19/00C12N15/62C12N15/63
Inventor丘小庆
OwnerPROTEIN DESIGN LAB LTD