A kind of colloidal gold test strip and kit for detecting Clostridium difficile
A colloidal gold test paper, the technology of Clostridium difficile, which is applied in the field of biomedicine, can solve the problems of routine detection of Clostridium difficile, poor sensitivity, harsh culture conditions, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] 1. Preparation of colloidal gold by two-step reduction method
[0038] a) The first reduction of chloroauric acid solution: 6ml of 0.0164mol / L HAuCL 4 Add 200ml double distilled water to the aqueous solution, boil for 30 minutes, stir slowly and add 50ml 0.016mol / L trisodium citrate solution. Vibrate ultrasonically at a frequency of 30kHZ for 2 minutes, cool to room temperature, and obtain a colloidal gold pronucleus solution with a particle size of 15nm.
[0039] b) The second reduction of the chloroauric acid solution: take 26ml of the colloidal gold pronuclear solution obtained after the first reduction and add 0.035mol / L HAuCL pre-cooled at 4°C under the condition of 4°C 4 Solution, stir slowly and add dropwise 0.018mol / L ascorbic acid and 0.138g / L PVP mixture solution pre-cooled at 4°C at a rate of 1-2 drops per second, react for 1 hour until the solution appears transparent wine red, that is, 40nm particle size colloidal gold solution.
[0040] 2. Preparation o...
Embodiment 2
[0060] Colloidal gold test strips were prepared according to the method in Example 1, except that the gRNA sequence was changed to TATAGTGGTTTAGTTAGAGT (SEQ ID NO.5).
PUM
| Property | Measurement | Unit |
|---|---|---|
| Particle size | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



