Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of colloidal gold test strip and kit for detecting Clostridium difficile

A colloidal gold test paper, the technology of Clostridium difficile, which is applied in the field of biomedicine, can solve the problems of routine detection of Clostridium difficile, poor sensitivity, harsh culture conditions, etc.

Active Publication Date: 2019-03-26
HANGZHOU GRAND BIOTECH CO LTD
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

CCTA and TC are currently the "gold standard" for detection of CDI, but they are difficult to be used in routine clinical detection of Clostridium difficile due to harsh culture conditions, high technical requirements, complex and time-consuming operations
EIAs detection is specific and fast, but the sensitivity is poor; GDH is relatively fast, but this method has cross-reactions, and some non-toxin Clostridium difficile can also secrete GDH, so false positives have occurred, the detection cost is high, and batch detection is required to reduce personnel costs. Operation and reagent costs, but at the same time prolong the detection cycle
The widely used PCR detection method at home and abroad is not suitable for primary hospitals and on-site rapid detection requirements due to high requirements for experimental equipment, cumbersome operation, and time-consuming.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of colloidal gold test strip and kit for detecting Clostridium difficile
  • A kind of colloidal gold test strip and kit for detecting Clostridium difficile
  • A kind of colloidal gold test strip and kit for detecting Clostridium difficile

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Preparation of colloidal gold by two-step reduction method

[0038] a) The first reduction of chloroauric acid solution: 6ml of 0.0164mol / L HAuCL 4 Add 200ml double distilled water to the aqueous solution, boil for 30 minutes, stir slowly and add 50ml 0.016mol / L trisodium citrate solution. Vibrate ultrasonically at a frequency of 30kHZ for 2 minutes, cool to room temperature, and obtain a colloidal gold pronucleus solution with a particle size of 15nm.

[0039] b) The second reduction of the chloroauric acid solution: take 26ml of the colloidal gold pronuclear solution obtained after the first reduction and add 0.035mol / L HAuCL pre-cooled at 4°C under the condition of 4°C 4 Solution, stir slowly and add dropwise 0.018mol / L ascorbic acid and 0.138g / L PVP mixture solution pre-cooled at 4°C at a rate of 1-2 drops per second, react for 1 hour until the solution appears transparent wine red, that is, 40nm particle size colloidal gold solution.

[0040] 2. Preparation o...

Embodiment 2

[0060] Colloidal gold test strips were prepared according to the method in Example 1, except that the gRNA sequence was changed to TATAGTGGTTTAGTTAGAGT (SEQ ID NO.5).

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Particle sizeaaaaaaaaaa
Login to View More

Abstract

The present disclosure provides a colloidal gold test strip for detecting Clostridium difficile, the colloidal gold test strip comprises a water-absorbing pad, a base film, a gold standard pad and a sample pad connected in sequence; the base film is provided with C line and T line, wherein, the dCas9 antibody is coated on the C line, and the tcdB gene fragment-bovine serum albumin complex is coated on the T line; the dCas9 labeled with colloidal gold is contained in the gold label pad ‑gRNA-protein-nucleic acid complex. The present disclosure provides a kit for detecting Clostridium difficile, wherein the kit includes the above-mentioned colloidal gold test strip for detecting Clostridium difficile. Through the above technical solution, the present disclosure replaces the commonly used colloidal gold detection developed by antigen-antibody combination with the specific recognition of dCas9-gRNA and DNA, which effectively improves the detection specificity and reaction sensitivity.

Description

technical field [0001] The disclosure relates to the field of biomedicine, in particular to a colloidal gold test strip and a kit for detecting Clostridium difficile. Background technique [0002] Clostridium difficile is one of the major pathogens causing enteric infections in hospitalized patients and is a drug-resistant bacterium that can cause fatal infections in hospitals and nursing facilities. The U.S. Centers for Disease Control and Prevention listed it as the top of the list of "the most urgent drug resistance threat in the United States". Clinically, about 30% of antibacterial drug-associated diarrhea (antibiotic associated Chronic colitis and 95% to 100% of pseudomembranous colitis (pseudomembranouscolitis, PMC) are caused by Clostridium difficile infection (CDI). CDI is mainly caused by the overgrowth of toxin-producing Clostridium difficile, which leads to the imbalance of intestinal flora and the release of toxins. The main clinical symptoms are fever, abdomin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569G01N33/558G01N33/577
CPCG01N33/558G01N33/56916G01N33/577G01N2333/24G01N2333/33G01N33/56911G01N33/54388
Inventor 李程丁秋蓉
Owner HANGZHOU GRAND BIOTECH CO LTD