Suspension culture method of adherent cells and application thereof

A technology of adherent cells and suspension culture, applied in the field of suspension culture of adherent cells, can solve problems such as high cost, cell apoptosis, and unsatisfactory cell density, and achieve the effect of improving production efficiency and survival rate

Active Publication Date: 2018-09-04
广州创瑞健康科技有限公司
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the cell lines obtained after adaptation in this way usually have the characteristics of aggregation in low serum culture, and are prone to aggregation in large-scale culture, such as tank culture of more than 1 ton, and the inside of the cell cluster is necrotic and apoptosis due to hypoxia. , leading to poor cell culture environment and unsatisfactory cell density, affecting subsequent antigen and protein production
In addition, there is a serum-free medium suspension method, which is not suitable for large-scale cultivation because of its high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Suspension culture method of adherent cells and application thereof
  • Suspension culture method of adherent cells and application thereof
  • Suspension culture method of adherent cells and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0038] 1. Human mmp3 gene cloning:

[0039] (1) Synthetic primers are as follows:

[0040] Primer PHMMPF3: 5'-TCGACCACCATGAAGAGTCTTCCAATCCT-3';

[0041] Primer PHMMPR3: 5'-TCAACAATTAAGCCAGCTGT-3'.

[0042] (2) Template cDNA preparation

[0043] I. Total RNA extraction

[0044] A. Add leukocyte separation solution to human peripheral blood, collect human blood leukocytes by centrifugation at 1500rpm, add 1ml Trizol (Invitrogen) solution, blow and mix well to fully lyse the cells, and let stand for 5 minutes;

[0045] B. Add 200 μl of chloroform, vigorously shake and mix for 30 seconds, make the aqueous phase and organic phase fully contact, and let stand at room temperature for 15 minutes;

[0046] C. Centrifuge at 10,000g for 15 minutes at 4°C. It can be seen that it is divided into three layers, and the RNA is in the upper aqueous phase. Move to another new RNase free EP tube;

[0047] D. Precipitate RNA: Add 0.5ml isopropanol, mix gently and fully, and let stand at room...

Embodiment 2

[0149] The operating steps are basically the same as in Example 1, except that the cell line used is VERO cells (ATCC-81), the human MMP10 gene is cloned, and recombined into the pcDNA3.1(+) vector.

[0150] Wherein, the primer sequences used are as follows:

[0151] Primer PHMMPF10: 5'-CTGGCTAGCCACCATGGAGCCACTGGCCATCCT-3';

[0152] Primer PHMMPR10: 5'-AGACTCGAGTCAGCAGAGGAGCCAGCTGT-3'.

[0153] The sequencing sequence of the MMP10 gene of the positive clone is as follows:

[0154]ATGGAGCCACTGGCCATCCTGGTGCTTCTGTGCCTGCCAGTCTCTTCAGCATATCCTCTGCATGGAGCAGTGAGGCAAGACCACCCAAGCATGGATCTTGCTCAGCAATATCTAGAAAAGTACTACAACTTTGAAAAAAATGAGAAACAAGTATTTAGAAGAAAGGACAGTAGTCCCATTGTCAAAAAAATCCAAGAAATGCAGAAGTTCCTCGGGCTGGAGGTGACAGGGAGGCTGGACTCCAGCACTATGGATGTGATGCTCAAGCCCAGGTGTGGCGTCCCCGATGTCGGTGGCTTCACCACCTTTCCAGGTTCACCAAAGTGGAGGGAAACAAACCTCACCTACAGGATTGTGAATTATACACCAGATTTACCGAAAGAGAGTGTGGACTCTGCTATTGAGAAAGCACTGAAAGTCTGGGAAGAGGTGACCCCACTCACATTCTCCAGGCGCTCTGAAGGAGAGGCTGACATAATGATCTCCTTCGCAGCTGGAGAACATG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Viable cell rateaaaaaaaaaa
Login to View More

Abstract

The invention discloses a suspension culture method of adherent cells and application thereof. The suspension culture method and the application provide modified adherent cells by high expression of transformation regulation medium matters related to cell suspension culture in the adherent cells; and then the modified adherent cells are cultured by the suspension culture method. The transformationregulation medium matters related to the cell suspension culture are subjected to higher level expression in the adherent cells, and the modified adherent cells are not prone to clustering in suspension culture, the improvement of cell survival rate is facilitated, the expression of foreign proteins or the preparation of virus vaccines is facilitated, and the production efficiency is improved. Therefore, the suspension culture method is particularly suitable for the production of recombinant proteins or the virus vaccines.

Description

technical field [0001] The invention relates to a cell culture method, in particular to a suspension culture method of adherent cells and its application. Background technique [0002] Suspension cell culture is mainly used in the large-scale production of some viral antigens and the expression of specific proteins. It is characterized by a simple method for cell expansion and culture, and can achieve large-scale culture. For example, a 1-ton to 10-ton bioreactor, the cell growth density can be up to 5×10 7 cells / ml, and without using microcarriers, the cost of cell culture is reduced to 40-70% of microcarrier culture. [0003] Usually isolated subcultured cells such as MDCK, VERO cells, PK-15, etc. are adherent cells, and the suspension culture can be achieved by gradually reducing the serum content in the medium until the suspension is achieved. However, the cell lines obtained after adaptation in this way usually have the characteristics of aggregation in low serum cult...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/85
CPCC12N9/50C12N9/6491
Inventor李军涛赵金红
Owner广州创瑞健康科技有限公司