Application of lncRNA TRALR (long-chain non-coding RNA TRALR)
A pair-and-reagent technology, applied in the application field of long-chain non-coding RNATRALR, can solve the problem that the specific mechanism has not been elucidated, and achieve the effect of important promotion and application prospect, profound clinical significance, and increasing sensitivity.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] Example 1 is to construct temozolomide-resistant T98G and U343 glioma cell lines
[0045] (1) IC50 was detected by MTS method: the cells were divided into 1×10 3 Seed in a 96-well plate at a density of / well, add a gradient concentration of temozolomide solution, and incubate at 37°C, 5% CO 2 Incubate for 72 h in an incubator. Add 20 μl MTS to each well. After incubating in the incubator for 2 h, the absorbance of each well was measured at 450 nm in a microplate reader. IC50 was calculated by SPSS software.
[0046] (2) Cell cycle detection by flow cytometry: the cells were divided into 1×10 6 The density was seeded in a 6-well plate, and temozolomide was added to incubate for 24 h. Digest the cells with trypsin, centrifuge at 1,000rpm for 4min after the digestion is terminated, and discard the supernatant. Wash the cells with ice-cold PBS, centrifuge at 1,000rpm for 4min, and discard the supernatant. Resuspend the cells in 100 μl PBS, slowly add 1ml 70-80% ethan...
Embodiment 2
[0047] Example 2 RT-PCR screening and verification of differentially expressed lncRNAs in glioma TMZ-resistant cells
[0048] (1) Extraction of total cellular RNA (TRIzol method)
[0049] The cells were seeded in 6-well plates and incubated in a 37°C, 5% CO2 incubator. After the cells were completely attached to the wall, 1000 μl TRIzol was added to each well. After standing still until completely dissolved, transfer to a 1.5ml EP tube. Add 0.2ml of chloroform, shake vigorously for 15 seconds, and place at room temperature for 3 minutes. Centrifuge at 4°C and 12000rpm for 15min, and transfer the supernatant to a new EP tube. Add 0.5ml of isopropanol and let stand at room temperature for 10min. After centrifugation at 4°C and 12,000 rpm for 10 minutes, a gelatinous precipitate appeared at the bottom of the EP tube. Discard the supernatant, wash the RNA pellet with 1ml 75℅ ethanol, and centrifuge at 4°C, 7500rpm for 5min, discard the supernatant again. After air-drying for...
Embodiment 3
[0072] Example 3 Smart Silencer Knockdown of lncRNA TRALR Causes G2 / M Phase Arrest and Inhibits Proliferation
[0073] 1) Inoculate cells: inoculate 1×10 5 ~5×10 5 Put the cells into the culture wells of a 24-well plate containing an appropriate amount of complete medium, so that the cell density at the time of transfection can reach 30-50%.
[0074] 2) Transfection step
[0075] For each transfection sample, prepare as follows:
[0076] a. Dilute lncRNASmart Silencer: use 30μl 1X riboFECT TM Dilute 2.5μl 20μM RiboTM lncRNASmart Silencer stock solution with CP Buffer and mix gently. The Smart Silencer sequence is as follows:
[0077] No. Target sequence (5'-3')
[0078] 1CCACCACTACAAAGCTTAA
[0079] 2CCTGTACATACCCAGATAA
[0080] 3CCTCTAACTAACATGACTT
[0081] 4GTAGGCACCTGACTTCGTGG
[0082] 5CTTGTGCAGGTGACAGGGAA
[0083] 6ACAGATTCGTGAGTGCCAGG
[0084] b. Mixture preparation: add 3μl riboFECT TM CP Reagent, gently pipette to mix, and incubate at room temperature for ...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com