Check patentability & draft patents in minutes with Patsnap Eureka AI!

Maker assisting in epilepsy diagnosis and detection kit thereof

A technology of kits and markers, applied in the field of markers and detection kits for auxiliary epilepsy diagnosis, which can solve the problems of lack of epilepsy diagnostic markers

Inactive Publication Date: 2018-09-11
THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0010] 3. Cryptogenic epilepsy
[0015] 2. Simple partial seizures
[0017] 3. Complex partial seizures
[0030] Early diagnosis and early treatment is an effective way to prevent and treat epilepsy, but there is currently a lack of markers related to the diagnosis of epilepsy

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Maker assisting in epilepsy diagnosis and detection kit thereof
  • Maker assisting in epilepsy diagnosis and detection kit thereof
  • Maker assisting in epilepsy diagnosis and detection kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] 1 KCNT1 mutation detection in a family with epilepsy

[0066] 1.1 Subjects: The proband and family members of Cai's epilepsy family from Fengdu County, Chongqing City. The genetic map of the family is as follows: figure 1 As shown, the test objects include 3 epilepsy patients (member 1 2 4 in the figure), 1 normal family member (member 3 in the figure); No. 1, No. 2, and No. 4: generalized tonic-clonic seizures; 3 Number: not sick. A detailed physical examination was performed on all family members No. 1-4, and blood samples were collected from each person after signing the informed consent.

[0067] 1.2 Sequencing:

[0068] The collected blood samples were sent to Beijing Mikino Gene Technology Co., Ltd. for sequencing for epilepsy gene mutation screening and verification, and the relationship between clinical phenotype and genotype was analyzed. The results are as follows:

[0069] Align the measured sequence with the normal KCNT1 standard sequence (https: / / www.ncb...

Embodiment 2

[0075] This embodiment provides a kit for detecting the mutation at the 1955th position of KCNT1, which includes: a primer for detecting whether the mutation G1955T occurs at the 1955th position of KCNT1, a forward primer: GACTCTGGTGATTTGCAGGAA, a reverse primer: GCATAGGCCAAGAGGAACTG; and a PCR amplification reagent: 10×Buffer (containing 15mM Mg 2+ ), dNTP (2.5Mm), high-fidelity DNA polymerase pfu DNA polymerase (5U / μl) and ddH 2 O.

[0076] The method for detecting whether the mutation G>T occurs at the 1955th position of KCNT1 using the kit mainly includes the following steps:

[0077] (1) Extract sample DNA and use it as a template to perform PCR reaction using the above-mentioned PCR reaction kit.

[0078] (2) Detection of multiple PCR products: Electrophoresis was performed on the PCR amplification products with agarose gel to detect whether the PCR amplification was successful, and the theoretical value of the amplified fragment was 600 bp.

[0079] (3) The PCR produ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a marker assisting in epilepsy diagnosis and a detection kit thereof, and relates to the field of epilepsy diagnosis. According to the study of the marker assisting in epilepsydiagnosis and the detection kit thereof, by detecting KCNT1 genes of family members of an epilepsy patient, the KCNT1 gene of the epilepsy patient in the family has a mutational c.G1955T, and mutation of the gene causes that the amino acid in the 652 site of KCNT1 protein corresponding to the c.G1955T changes from glutamic acid (G) to valine (V), which is missense mutation. Both nucleic acid molecules containing c.G1955T mutation or protein containing mutational p.G652V can be used as a biomarker for epilepsy diagnosis, so that a fast and reliable detection assisting marker is provided for epilepsy diagnosis at the molecular level.

Description

technical field [0001] The present invention relates to the field of epilepsy diagnosis, in particular to a marker for assisting epilepsy diagnosis and a detection kit thereof. Background technique [0002] Epilepsy is a syndrome of chronic recurrent transient brain dysfunction. It is characterized by recurrent epileptic seizures caused by highly synchronized abnormal discharge of brain neurons. Epilepsy is one of the common diseases of the nervous system, second only to stroke in prevalence. The incidence of epilepsy is age-related. It is generally believed that the prevalence rate is the highest within 1 year of age, and gradually decreases after 1 to 10 years of age. The ratio of male to female patients with epilepsy in my country is (1.15-1.7):1. [0003] The etiology of epilepsy is extremely complex and can be divided into three categories, and there are many factors that affect the onset: [0004] 1. Idiopathic epilepsy [0005] Suspicious genetic predisposition ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12Q1/6837C12N15/11
CPCC12Q1/6837C12Q1/6883C12Q2600/156
Inventor 田鑫王学峰王唯肖飞阳勇马远林胡以达徐馨谷万杰杨艺
Owner THE FIRST AFFILIATED HOSPITAL OF CHONGQING MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More