Maker assisting in epilepsy diagnosis and detection kit thereof
A technology of kits and markers, applied in the field of markers and detection kits for auxiliary epilepsy diagnosis, which can solve the problems of lack of epilepsy diagnostic markers
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] 1 KCNT1 mutation detection in a family with epilepsy
[0066] 1.1 Subjects: The proband and family members of Cai's epilepsy family from Fengdu County, Chongqing City. The genetic map of the family is as follows: figure 1 As shown, the test objects include 3 epilepsy patients (member 1 2 4 in the figure), 1 normal family member (member 3 in the figure); No. 1, No. 2, and No. 4: generalized tonic-clonic seizures; 3 Number: not sick. A detailed physical examination was performed on all family members No. 1-4, and blood samples were collected from each person after signing the informed consent.
[0067] 1.2 Sequencing:
[0068] The collected blood samples were sent to Beijing Mikino Gene Technology Co., Ltd. for sequencing for epilepsy gene mutation screening and verification, and the relationship between clinical phenotype and genotype was analyzed. The results are as follows:
[0069] Align the measured sequence with the normal KCNT1 standard sequence (https: / / www.ncb...
Embodiment 2
[0075] This embodiment provides a kit for detecting the mutation at the 1955th position of KCNT1, which includes: a primer for detecting whether the mutation G1955T occurs at the 1955th position of KCNT1, a forward primer: GACTCTGGTGATTTGCAGGAA, a reverse primer: GCATAGGCCAAGAGGAACTG; and a PCR amplification reagent: 10×Buffer (containing 15mM Mg 2+ ), dNTP (2.5Mm), high-fidelity DNA polymerase pfu DNA polymerase (5U / μl) and ddH 2 O.
[0076] The method for detecting whether the mutation G>T occurs at the 1955th position of KCNT1 using the kit mainly includes the following steps:
[0077] (1) Extract sample DNA and use it as a template to perform PCR reaction using the above-mentioned PCR reaction kit.
[0078] (2) Detection of multiple PCR products: Electrophoresis was performed on the PCR amplification products with agarose gel to detect whether the PCR amplification was successful, and the theoretical value of the amplified fragment was 600 bp.
[0079] (3) The PCR produ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 



