High-yield poly-γ-glutamic acid engineering bacteria and its construction method and application
A technology of glutamic acid and engineering bacteria, which is applied in the fields of genetic engineering and microbial fermentation to achieve the effects of increasing the yield of γ-PGA, increasing the yield and increasing the modification effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1 Construction of pHY-dltB expression plasmid
[0038] According to the gene sequence of the dltB gene in the bacillus licheniformis WX-02 genome DNA sequence, design the upstream primer (dltB-F) and the downstream primer (dltB-R) of the dltB gene; And take the genome DNA of bacillus licheniformis WX-02 as Template, obtained dltB gene fragment (1158bp) by PCR amplification;
[0039] Among them, the sequences of dltB-F and dltB-R are:
[0040] dltB-F:TAGGTAAGAGAGGAATGTATCACATGACACCCTATGGTTCATTTCdltB-R:GAAATCCGTCCTCTCTGCCTTTTTAGTGTATTAGTTCCCTGAG
[0041] Using the genomic DNA of Bacillus subtilis 168 as a template, the P43 promoter was amplified by PCR (primers used were P43-F and P43-R); using the genomic DNA of Bacillus licheniformis WX-02 as a template, amylase was amplified by PCR terminator (primers used are TamyL-F and TamyL-R), and then the promoter, gene of interest and terminator are ligated together by SOE-PCR (primers used are P43-F and TamyL-R) to fo...
Embodiment 2
[0050] Example 2 Construction of Bacillus licheniformis WX-02 / pHY-dltB
[0051] The free expression vector pHY-dltB was transferred into Bacillus licheniformis WX-02 (disclosed in Chinese patent CN106497857A), and under the condition of 37°C, the medium containing tetracycline resistance was screened to obtain transformants. Plasmids were verified by colony PCR (primers used were: pHY-F and pHY-R). The PCR verification result of the positive transformant is an electrophoretic band at 2230bp, combined with the sequence determination results, it is proved that the free expression vector pHY-dltB was successfully transferred into Bacillus licheniformis WX-02, Bacillus licheniformis WX-02 / pHY-dltB) The construction was successful, and the control strain WX-02 / pHY300 was to transform the plasmid pHY300 into WX-02, and the operation steps were the same as those for the construction of WX-02 / pHY-dltB.
Embodiment 3
[0052] Example 3 Fermentation test of Bacillus licheniformis WX-02 / pHY-dltB to produce γ-PGA
[0053] 1. Seed culture
[0054] Activate Bacillus licheniformis WX-02 / pHY-dltB and WX-02 / pHY300, that is, inoculate 1% by volume from a glycerol tube into 5mL LB medium, culture at 180-300r / min at 37°C for 10 ~14 hours, then inoculate the bacterium solution after the activation of the strain on the medium for seed fermentation with a volume percentage of 1% inoculum, and then cultivate it at 180-300r / min and 37°C for 10-12 hours to obtain the seed-cultured bacteria liquid.
[0055] 2. Production of γ-PGA by fermentation
[0056] In order to better analyze the effect of dltB expression on the production of γ-PGA by Bacillus licheniformis fermentation, fermentation experiments were carried out using the media shown in Table 1, respectively.
[0057] The formula of table 1 fermentation medium
[0058]
[0059]
[0060] Other ingredients in the 18 media are: 10g / L sodium citrat...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com